Эпидемиологическое и клинико-генетическое исследование наследственного гипотрихоза в республике чувашия

Представлены сведения о предстоящей защите диссертации на соискание ученой степени кандидата медицинских наук

Абрукова Анна Викторовна

«Эпидемиологическое и клинико-генетическое исследование наследственного гипотрихоза в Республике Чувашия»

03.00.15 – генетика; 14.00.11 –кожные и венерические болезни

медицинские науки

Д 001.016.01

ГУ Медико-генетический НЦ РАМН

115478, Москва, ул. Москворечье, 1, МГНЦ РАМН

Тел: 8 (499) 612-86-07

www. med-gen. ru

Предполагаемая дата защиты диссертации – 24 сентября 2007 года

Представлена на сайте МГНЦ РАМН – 25.07.2007

Работа принята к защите 09.07.2007

На правах рукописи



03.00.15. генетика

14.00.11. кожные и венерические болезни


диссертации на соискание ученой степени

кандидата медицинских наук

Москва 2007

Работа выполнена в Государственном учреждении Президентский перинатальный центр г. Чебоксары и Государственном учреждении Медико-генетический научный центр Российской Академии медицинских наук

Научный руководители: доктор медицинских наук

Зинченко Рена Абульфазовна

доктор медицинских наук

профессор Суворова Ксения Николаевна

Официальные оппоненты: доктор медицинских наук, профессор

Журков Вячеслав Серафимович

доктор медицинских наук, профессор

Суколин Геннадий Иванович

Ведущая организация: Государственное образовательное учреждение дополнительного профессионального образования Российская медицинская академия последипломного образования МЗ РФ

Защита состоится "24"сентября 2007 г. в 11-00 часов на заседании Диссертационного совета Д 001.016.01 при ГУ МГНЦ РАМН по адресу: 115478, Москва, ул. Москворечье, д.1.

С диссертацией можно ознакомиться в библиотеке Государственного учреждения Медико-генетический научный центр РАМН по адресу: 115478, Москва, ул. Москворечье, д.1.

Автореферат разослан "_____" ___________2007 г.

Ученый секретарь диссертационного совета Д 001.016.01,

доктор биологических наук, профессор Л.Ф.Курило


Актуальность проблемы. Волосам в жизни человека отводится всего несколько функций, но их социальная и косметическая роль настолько значимы, что потеря волос может быть равноценна утрате части тела. При большой заинтересованности пациентов мало изучены и до конца не ясны молекулярные механизмы, контролирующие рост и потерю волос у человека.

В мировой литературе описано всего 14 нозологических форм, связанных с изолированной потерей волос. При этом синдромов, компонентом которых является гипотрихоз или дистрофия стрежня волоса, существует более 250. В основном, изучение и описание новых форм изолированного поражения волос происходит при обнаружении его накопления в географических изолятах.

Предварительные генетико-эпидемиологические исследования по выявлению широкого круга моногенных наследственных заболеваний, проведенные в 6 районах Республики Чувашия и 7 районах Республики Марий Эл, выявили группу семей со схожими клиническими проявлениями, характерными для изолированного рецессивного гипотрихоза. Данное состояние ранее не регистрировалось и было занесено в международный каталог наследственных болезней как новое наследственное заболевание – тотальный гипотрихоз, марийский тип, т.к. впервые выявлено среди марийцев Республики Марий Эл. По клинико-генеалогическим данным и проведенному сегрегационному анализу установлен рецессивный тип наследования; распространенность заболевания составила 1:14298 у марийцев и 1:9529 у чувашей.

Предпринятая попытка установления молекулярной природы заболевания, выявленного среди марийского и чувашского населения, не показала наличия сцепления с локусом 8p21-22, ответственным за различные формы атрихии или гипотрихоза.

Настоящее исследование предусматривало комплексное генетико-эпидемиологическое, клинико-генеалогическое и лабораторное изучение наследственного изолированного гипотрихоза в рамках всей Республики Чувашия. В России комплексные клинико-генетические исследования семейных случаев изолированного гипотрихоза или дефицита роста волос ранее не проводились.

Помимо научной основы данная работа призвана решить ряд клинических вопросов, касающихся данного заболевания, в том числе и медико-генетическое консультирование семей с гипотрихозом в республике. Кроме того, данное исследование позволит планировать проведение эффективной профилактики повторных случаев заболевания в семьях с гипотрихозом.

Целью настоящего исследования явилось изучение эпидемиологических, клинико-генетических и молекулярных особенностей распространения наследственного гипотрихоза в Республике Чувашия.

Для осуществления поставленной цели решались следующие задачи исследования:

  1. Описать клинические особенности врожденного наследственного гипотрихоза на основании комплексного клинико-генеалогического и лабораторного анализа;
  2. Определить основные дифференциально-диагностические критерии в диагностике клинически различных форм врожденного наследственного гипотрихоза;
  3. Изучить территориальные особенности распространения врожденного наследственного гипотрихоза в Республике Чувашия;
  4. Определить молекулярно-генетическую природу наследственного гипотрихоза в Республике Чувашия;
  5. Разработать алгоритм обследования пациентов с врожденным наследственным гипотрихозом и создать научно-обоснованную базу для мониторинга больных.

Научная новизна. В настоящей работе впервые проведено клинико-генетическое и эпидемиологическое исследование наследственного изолированного гипотрихоза в Республике Чувашия. Впервые показано, что на территории Республики Чувашия обнаружены две различные формы гипотрихоза (тип 1 и 2), различающиеся по клиническим, лабораторным и генетическим характеристикам. Впервые описаны основные клинико-диагностические и лабораторные критерии диагностики гипотрихоза, а также проанализирован внутрисемейный и межсемейный клинический полиморфизм заболевания. Для гипотрихоза 1 типа, наибольшей по количеству пациентов, определена молекулярно-генетическая природа заболевания, причиной которого является делеция 4 экзона гена LIPH, кодирующего лизофосфолипазу Н. Впервые показано участие гена LIPH в формировании и росте волос. У больных с гипотрихозом тип 2 делеции 4 экзона гена LIPH не обнаружено. Определено, что для изолированного наследственного гипотрихоза в Республике Чувашия характерен аутосомно-рецессиный тип наследования.

Получены значения распространенности и особенности территориального распределения изолированного аутосомно-рецессивного гипотрихоза по районам республики. Установлена частота делеции 4 экзона гена LIPH среди здоровых доноров различных этнических групп России, наибольшая у марийцев и чувашей. На основании комплексного клинико-генетического, лабораторного и молекулярного обследования больных оценены основные дифференциально-диагностические критерии для диагностики различных форм гипотрихоза и разработан алгоритм обследования больных.

Практическая значимость.

На основании комплексного клинико-генетического, лабораторного и молекулярного обследования больных оценены основные дифференциально-диагностические критерии для диагностики различных форм гипотрихоза в Республике Чувашия. Разработан алгоритм обследования больных и создана основа для регионального регистра и мониторинга больных гипотрихозом. Проведено медико-генетическое консультирование в семьях с наследственным гипотрихозом.

Положения, выносимые на защиту:

  1. На территории Республики Чувашия выявлены 2 клинически разные формы изолированного рецессивного гипотрихоза (гипотрихоз тип 1 и 2), различающиеся по клинической картине, циклическим и структурным изменениям развития и роста волос. Все больные по национальности чуваши.
  2. На семьях больных гипотрихозом тип 1 выполнено картирование гена LIPH, ответственного за развитие заболевания. Найдена делеция 4 экзона гена LIPH (985 п.н.). У больных гипотрихозом 1 типа делеция 4 экзона гена LIPH выявлена в гомозиготном состоянии, у их родителей в гетерозиготном. Исследование больных гипотрихозом 2 типа и их родителей на носительство делеции 4 экзона гена LIPH не показало наличие этого мутационного изменения.
  3. Частота гипотрихоза тип 1, обусловленного делецией 4 экзона гена LIPH, составляет среди чувашей 1:1350; среди марийцев 1: 2746, среди удмуртов 1:51020, среди башкир 1:103092.
  4. Разработаны дифференциально-диагностические критерии и алгоритм медико-генетического консультирования, позволяющие диагностировать различные формы изолированного наследственного рецессивного гипотрихоза на территории Республики Чувашия. Создана основа для регионального регистра и мониторинга больных наследственным гипотрихозом.

Апробация работы. Результаты работы представлены на: V-ом Съезде Медицинских генетиков, Уфа, май 2005; V Российском Конгрессе «Современные технологии в педиатрии и детской хирургии», Москва, октябрь 2006; в Медико-генетической консультации г. Чебоксары ГУЗ «Президентский перинатальный центр»; на межлабораторном семинаре в лабораториях генетической эпидемиологии, ДНК-диагностики и НПО ГУ МГНЦ РАМН. Работа апробирована и рекомендована к защите на заседании научного семинара ГУ МГНЦ РАМН 27 июня 2007 года.

Публикации. По теме диссертации опубликовано 9 печатных работ.

Структура и объем работы. Диссертационная работа изложена на 129 страницах машинописного текста и состоит из введения, обзора литературы, материалов и методов исследования, результатов и обсуждения, заключения, выводов, практических рекомендаций и списка литературы, включающего 140 источника (105 на русском и 35 на иностранных языках). Диссертация иллюстрирована 36 рисунками, 14 таблицами и дополнена приложением (7 стр.).


Сбор материала проводили в два временных периода:

1) В процессе генетико-эпидемиологического изучения широкого спектра моногенной наследственной патологии (более 2500 нозологических форм) населения 6 районов (Чебоксарского, Канашского, Моргаушского, Цивильского, Мариинско-Посадского и Алатырского) Республики Чувашия в период 1998-2001 гг. Работа проведена в соответствии со стандартным протоколом генетико-эпидемиологических исследований, применяемым на протяжении более чем 30-летней работы лаборатории генетической эпидемиологии Медико-генетического научного центра РАМН [«Медико-генетическое описание населения Адыгеи», 1997; «Наследственные болезни в популяциях человека», 2002; «Генетическая структура и наследственные болезни чувашской популяции», 2006]. В результате медико-генетического обследования у чувашей была выявлена высокая распространенность изолированного рецессивного гипотрихоза, зарегистрированного ранее только среди марийцев Республики Марий Эл. При этом также выявлены 2 семьи с доминантным наследованием у марийцев и 2 семьи у чувашей. Полученные результаты инициировали дальнейшие исследования по гипотрихозу.

2) В период с 2003-2006 гг. проводили исследование по выявлению больных наследственным гипотрихозом на всей территории Республики Чувашия (21 район и 5 городов).

Информация о больных гипотрихозом была получена из трех основных источников регистрации: из результатов первичного генетико-эпидемиологического исследования 6 районов Чувашии, от врачей-дерматологов, педиатров, терапевтов (при помощи метода анкетирования и устных выступлений) всех обследованных районов и городов Чувашии, от фельдшеров из сельских районов республики Чувашия. Суммарная численность обследованного населения составила 1,335916 млн. человек, из которых чуваши составляют 67,51% (81,58% в селе и 58,60% в городах Чувашии) с повторным исследованием предыдущих 6 районов (табл.1).

Таблица 1. Численность обследованных районов Чувашской Республики.

№№ Районы и города Всего население Дети до 18 лет чуваши остальные нац.
% абс. % абс.
1 Алатырский 22600 3910 25,00% 5650 75,00% 16950
2 Аликовский 22100 5209 98,00% 21658 2,00% 442
3 Батыревский 46900 10395 75,00% 35175 25,00% 11725
4 Вурнарский 44200 9927 91,00% 40222 9,00% 3978
5 Ибресинский 28500 7234 83,00% 23655 17,00% 4845
6 Канашский 43700 10290 73,00% 31901 27,00% 11799
7 Козловский 26600 5182 70,00% 18620 30,00% 7980
8 Комсомольский 28200 6918 73,00% 20586 27,00% 7614
9 Красноармейский 18500 4180 98,00% 18130 2,00% 370
10 Красночетайский 22700 4415 97,00% 22019 3,00% 681
11 Марпосадский 28200 5857 79,40% 22391 20,60% 5809
12 Моргаушский 37500 8751 98,00% 36750 2,00% 750
13 Порецкий 18600 3100 5,00% 930 95,00% 17670
14 Урмарский 29100 6548 97,00% 28227 3,00% 873
15 Цивильский 37100 8190 90,00% 33390 10,00% 3710
16 Чебоксарский 59300 13479 91,00% 53963 9,00% 5337
17 Шемуршинский 17200 4135 78,00% 13416 22,00% 3784
18 Шумерлинский 15100 2675 80,00% 12080 20,00% 3020
19 Ядринский 36000 7970 84,00% 30240 16,00% 5760
20 Яльчикский 27500 5726 97,00% 26675 3,00% 825
21 Янтиковский 19300 4621 90,00% 17370 10,00% 1930
По селу 628900 138712 81,58% 513048 18,42% 115852
22 г. Чебоксары 454321 94418 62,30% 283042 37,70% 171279
23 г.Новочебоксарск 125763 26238 54,30% 68289 45,70% 57474
24 г. Шумерля 35194 6677 23,60% 8306 76,40% 26888
25 г.Алатырь 42669 7661 3,20% 1365 96,80% 41304
26 г.Канаш 49069 11030 56,80% 27871 43,20% 21198
По городам 707016 146024 58,60% 388874 41,40% 292724
Всего по ЧР 1 335 916 284736 67,51% 901921 32,49% 433995

Методы исследования.

Всего получена информация о 111 больных из 76 семей. Из всех зарегистрированных больных методом клинико-генеалогического анализа исключены пациенты с известным синдромальным и приобретенным поражением волос. У оставшихся больных (96 больных из 63 семей) с изолированным поражением волосяного покрова для исключения сопутствующей соматической патологии проведено УЗ-сканирование внутренних органов, клинико-лабораторное обследование крови (общий и биохимический анализ), мочи, исследование электролитного, иммунного и липидного баланса. Исследованы волосы и функции желез кожи (пото- и салоотделение).

Исследование волос включало: подсчет количества волос на кв. см., трихограмму (оценка фаз роста), световую и электронную микроскопию (оценка структурных изменений стержня волос) и гистологическое исследование биоптатов кожи волосистой части головы (состояние волосяных фолликулов).

Собранный клинический материал подвергали сегрегационному анализу, цель которого заключается в проверке соответствия распределения больных и здоровых в выявленных ядерных семьях согласно определенному типу наследования – аутосомно-рецессивному. Учитывая множественную регистрацию пациентов с гипотрихозом, расчет сегрегационной частоты проводился согласно пробандовому методу Вайнберга, а вероятность регистрации оценивалось по методу Фишера.

Расчет распространенности проводили исходя из реального соотношения количества больных с определенным типом наследственной патологии к численности обследованной популяции (чуваши), и вычислялся по формуле:

f=n /N,

где n - число больных, N - численность популяции. Сравнение распространенности наследственного гипотрихоза между районами проводилось методом -квадрат, а в случаях, когда в рассматриваемой группе наблюдалось меньше 5 больных статистикой – t-критерий Стьюдента.

Для изучения равномерности территориального распространения наследственного гипотрихоза по районам и городам Республики Чувашии было использовано F-распределение, а накоплением считались только те случаи, когда уровень значимости < 0,05 [Животовский Л.А., 1992].

Картирование и идентификация гена (делеции 4 экзона гена LIPH), ответственного за развитие наследственного аутосомно-рецессивного гипотрихоза выполнено группой ученых под руководством проф. Рогаева Е.И. из исследовательского института нейропсихиатрии Брудник. Выделение ДНК из периферической крови осуществляли методом фенольно-хлороформной экстракции, анализ делеции 4 экзона гена LIPH проведен методом полимеразной цепной реакции (ПЦР) синтеза ДНК. В лаборатории генетической эпидемиологии ГУ МГНЦ РАМН Шароновой Е.И. модифицирован метод идентификации данной мутации – разработаны новые праймеры. Работа выполнена с использованием пары праймеров: 2) 5'–CCCTACTGTTGAGCTCTGCAT–3' и 5'–CGTTACCATCAGTGTCGGAAT–3'.

На носительство делеции 4 экзона гена LIPH обследованы 109 человек: больные гипотрихозом (64) и их родители (41).

Для определения популяционной частоты делеции 4 экзона гена LIPH исследовали здоровых индивидуумов-чувашей, а также здоровых индивидуумов других национальностей: марийской, удмуртской, башкирской и русской (табл.2). Исследование было добровольным. От всех индивидуумов получено письменное информированное добровольное согласие на проведение данного исследования.

Работа по изучению частоты делеции 4 экзона гена LIPH проведена сотрудниками лаборатории из исследовательского института нейропсихиатрии Брудник и в лаборатории генетической эпидемиологии ГУ МГНЦ РАМН.

Таблица 2. Количество образцов крови от здоровых индивидов.

Этносы Число образцов ДНК от здоровых индивидов (Рогаев Е.И. с сотр.) Число образцов ДНК от здоровых индивидов (лаб. генет.эпидем.) Итого вошедших в наш анализ
Чуваши * 122 264 386
Марийцы * 100 211 311
Удмурты* 84 142 226
Башкиры** 321 321
Русские*** 405 405
Всего 711 938 1649

Примечание: (*) – ДНК здоровых индивидов из коллекции лаборатории генетической эпидемиологии ГУ МГНЦ РАМН; (**) – ДНК здоровых индивидов из коллекции лаборатории молекулярной генетики УНЦ РАН; (***) – ДНК здоровых индивидов из коллекции Рогаева Е.И. (ЦПЗ РАМН).


В общей совокупности после выявления больных гипотрихозом из основных источников регистрации нами зарегистрированы 76 семей (111 больных). Проведенное медико-генетическое обследование, осмотр и сбор генеалогических данных позволил исключить из рассматриваемой выборки пациентов 5 больных из 4 семей с известной синдромальной патологией и 10 больных из 9 семей с приобретенной формой гипотрихоза (гнездная алопеция). В рассмотрении остались 96 больных из 63 семей с изолированным наследственным гипотрихозом.

При проведеннии в обеих группах общеклинического обследования всех пациентов с гипотрихозом не обнаружено специфических изменений со стороны внутренних органов и нарушения функции желез кожи (пото- и салоотделение). Половое созревание у всех больных протекало нормально, фертильность была сохранена. Анализ внешнего вида и исследования волос пациентов с изолированным гипотрихозом (96 больных из 63 семей) разделили всех больных на две группы, которые условно были обозначены как гипотрихоз тип 1 и тип 2.

Клиническая и лабораторная характеристика гипотрихоза 1 и 2 типов.

Первый тип гипотрихоза выявлен у 84% больных и характеризовался редкими волосами (от 1-2 до 75 волос на кв. см., норма 346-460 на кв.см. [Мяделец О.Д., Адаскевич В.П, 2006]), длина волос в среднем составляла от 3 до 5 см. Отмечали выраженную сухость и тусклость волос скальпа; больные не стриглись с рождения; в 2 случаях наблюдали тотальную алопецию после смены пушковых волос. Заболевание прогрессировало с возрастом (рис.1, а-е).


б) в)




Рис. 1 (а-е). Больные гипотрихозом 1 типа.

В первой группе наблюдали выраженный внутрисемейный полиморфизм (рис.2, а и б).



Рис. 2. а) и б) – сибсы из семьи Е.: а) волосы очень редкие, почти прямые, светлые; б) волосы гуще, кучерявые, русого цвета.

У больных второй группы волосы шерстистые, на вид гуще, длиннее (от 5 до 15 см), имеют умеренный естественный блеск, рост волос замедлен (стригутся 1 раз в 3-4 года). У больных гипотрихозом 2 типа также выявлен выраженный межсемейный клинический полиморфизм. Оценить степень внутрисемейного полиморфизма, как и прогрессирование течения заболевания, нам не удалось из-за ограничения возрастной категории и общего количества больных (рис.3, а-в).


б) в)

Рис. 3 (а-в). Больные гипотрихозом 2 типа.

Поражение волос лица и тела было идентичным у больных обеих групп: скудный рост бровей и ресниц (рис.4 а), волос подмышечной области (рис.4 б и в) и практически отсутствие волос на теле у большинства пациентов. У мужчин вырастают борода и усы, но бреются они редко – 1 раз в 7-10 дней.

При проведении лабораторного исследования волос пациентов с гипотрихозом 1 типа обнаружены следующие изменения:

1) по результатам трихограммы отмечено нарушение фаз роста (60-70% волос в фазе покоя – телогена);

а) б) в)

Рис. 4. Гипотрихоз бровей и ресниц (а), подмышечной области (б и в).

2) световая и электронная микроскопия показали мелкоизвилистую неровность контуров стержня, выраженные различия диаметра и пигментации волос; изломы стержня волоса в проксимальной части (продольные и поперечные – трихорексис, узловатая ломкость волос – трихорексис нодоза) (рис.5, а и б), уменьшение диаметра волос в 2 раза по сравнению с нормой, дистрофические изменения кутикулы (рис.5, в).

а) б) в)

Рис. 5, а – различная пигментация и диаметр волос; б – трихорексис нодоза при световой микроскопии, в – уменьшение диаметра волоса (25 микрон при норме 40-150 мкм [Мяделец О.Д., Адаскевич В.П, 2006.

3) при гистологическом исследовании биоптатов кожи волосистой части головы выявлены дилатация волосяных фолликулов с истончением эпителия и нарушением кератинизации (указано скобкой) выше места прикрепления сальной железы, снижение нормального зернистого слоя с преждевременной дифференциацией эпителия и явным паракератозом (рис.6,а и б).

При лабораторном исследовании пациентов с гипотрихозом 2 типа не выявлено значительных циклических и структурных дефектов.

Таким образом, определены дифференциально-диагностические критерии, позволяющие диагностировать различные формы изолированного наследственного гипотрихоза на территории Чувашии (табл.3).

а) б) а) дилатация фолликулов, нарушение клеточной дифференцировки,-23 б) а) дилатация фолликулов, нарушение клеточной дифференцировки,-24

Рис. 6. а) дилатация фолликулов, нарушение клеточной дифференцировки, паракератоз, б) здоровый контроль (черные линии показывают одинаковую ориентацию препаратов).

Таблица 3. Дифференциально-диагностические критерии гипотрихоза 1 и 2 типов.

Клинические критерии гипотрихоза
Критерии оценки 1 тип 2 тип
Внешний вид волос больных гипотрихозом Волосы очень редкие, сухие и тусклые Редкие, шерстистые, создающие эффект густоты волос, умеренный естественный блеск
Длина волос в среднем 3-5 см от 5 до 15 см
Скорость роста волос не стриглись с рождения подравниваются 1 раз в 3-4 года
Течение заболевания прогрессирование заболевания с возрастом не известно
Лабораторные критерии
Подсчет волос на кв.см. от 1-2 до 75 волос на кв. см. 90-210 волос на кв.см.
Трихограмма 60-70% волос находятся в стадии телогена, 30-40% в стадии анагена; легко выдергиваются 75% - в стадии анагена 25% волос в стадии телогена
Световая и электронная микроскопия выраженные дистрофические изменения волос незначительные структурные изменения (некоторая неровность контуров, единичные изломы стержня)

Сегрегационный анализ для семей с предположительно аутосомно-

рецессивной патологией

При выявлении больных популяционными методами для подтверждения типа наследования (аутосомно-рецессивный типа наследования гипотрихоза) необходимо проведение генетического анализа в выявленных семьях. Для проведения сегрегационного анализа были отобраны 52 семьи, в которых родители были здоровы и имели одного или более (всего 68) больных детей, т.е. предполагался аутосомно-рецессивный тип наследования. Из них 16 имели одного (пораженного) ребенка, и, следовательно, были неинформативны для проведения генетического анализа. Таким образом, в сегрегационный анализ вошли 52 больных из 36 семей.

Сегрегационная частота методом максимального правдоподобия с учетом вероятности регистрации, составила 0,297 (26/92), а при помощи метода Фишера с учетов вероятности регистрации без коррекции по мульплексным семьям составила 0,31±0,12, (доля спорадических случаев х = 0,13±0,07). Полученные результаты подтверждают аутосомно-рецессивное наследование заболевания в выявленных семьях с гипотрихозом (ожидаемая 0,25).

Картированиеи идентификация гена, ответственного за развитие

изолированного наследственного гипотрихоза.

Картирование и идентификация гена, ответственного за развитие наследственного гипотрихоза анализом сцепления было проведено группой ученых под руководством проф. Рогаева Е.И. из исследовательского института нейропсихиатрии Брудник на образцах крови 14 марийских семей. Было показано потенциальное сцепление заболевания с хромосомой 3, локус 3q26-27 и выделен интервал между 2 маркерами (D3S1617 и D3S3583), содержащий 17 генов, ранее никогда не связанных с заболеваниями роста волос, lod score определен в интервале между 5 и 6. В дальнейшем при сочетании этих данных с анализом гаплотипов в 36 чувашских семьях была определена область в ~350 тыс.п.н., содержащая 4 кодирующих гена в данном регионе (MAP3K13, TMEM41A, LIPH и SENP2). При последовательном исключении остановились на гене LIPH как наиболее вероятном кандидате (рис.7).

Секвенирование гена LIPH показало наличие делеции всего 4 экзона гена LIPH (участок 985 пн.) в гомозиготном состоянии у обследованных больных (марийцев и чувашей) и в гетерозиготном состоянии у их родителей.

Ген LIPH был открыт в 2002 году Sonoda H. и Jin W., содержит 10 экзонов и кодирует фермент (451 аминокислота) – липазу Н (фосфолипаза А1 (PLA1) из большого семейства триглицеридных липаз. [MсKusick V.A., http://www.ncbi.nlm.nih.gov/OMIM, 2007]. На сегодняшний день известно, что липаза Н вместе с тремя другими высокогомологичными – лизофосфолипазами: LIPI, PS-PLA1 и LysoPLD продуцирует 2-ацил лизофосфатидную кислоту (LPA) из фосфатидной кислоты. Доказано участие LPA во многих функциях организма: пролиферация, антиапоптотическая активность, организация цитоскелета, а также участие в передаче сигнала через семейство рецепторов, связанных с G-белком.

Рис. 7. Генетическая карта локуса 3q26-27, показывающая сцепление локуса с гипотрихозом.

Поскольку функции этих лизофосфолипаз перекрываются, предполагалось, что потеря функции одной из них компенсируется другими. Но, при сравнении паттерна их экспрессии обнаружено, что только лизофосфолипаза Н (LIPH) экспрессируется в волосяных фолликулах человека, в месте локализации стволовых клеток.

На рис.8 а показана делеция 4 экзона гена LIPH и уровень экспрессии гена в различных тканях человека (рис.8 б).

 а) б) Рис.8,а и б. Как видно из рис. 8б экспрессия мДНК наибольшая в-26


 б) Рис.8,а и б. Как видно из рис. 8б экспрессия мДНК наибольшая в-27


Рис.8,а и б.

Как видно из рис. 8б экспрессия мДНК наибольшая в анагеновых лукицах, фолликулах, особенно в месте локализации стволовых клеток. Это может объяснить, почему мутации в гене LIPH приводят к нарушениям роста волос.

После картирования гена LIPH и идентификации мутации пакистанскими исследователями подтверждено участие данного гена в развитии и росте волос, нашедшими мутацию во втором экзоне гена LIPH, приведшую к развитию гипотрихоза с рецессивным типом наследования в большой пакистанской семье [Martinez-Mir A.et al., 2007].

Исследование больных и их родителей на носительство делеции 4 экзона гена LIPH.

Молекулярно – генетическое исследование на носительство делеции 4 экзона гена LIPH методом ПЦР проведено 109 индивидуумам: 56 больных и 38 родителей с гипотрихозом 1 типа, 12 больных и 3 родителя с гипотрихозом 2 типа (табл.4).

Таблица 4. Результаты исследования на носительство делеции 4 экзона гена LIPH.

Группы Гомозиготные носители Гетерозигот-ные носители Без делеции
Больные гипотрихозом 1 группы/ из них 3 родителя 56/3 0 0
Родители больных 1 группы 35 0
Больные гипотрихозом 2 группы/из них 2 родителя 0 1 11/2
Родители больных 2 группы 0 0 1

Делеция 4 экзона гена LIPH в гомозиготном состоянии выявлена у всех больных гипотрихозом 1 типа, из них у 3 родителей пробандов (семьи с предполагаемым доминантным наследованием); остальные родители оказались гетерозиготными носителями делеции 4 экзона гена LIPH. Среди больных гипотрихозом 2 типа гомозиготные носители не выявлены, у 1 больного – гетерозиготное носительство, что можно объяснить либо высокой частотой данной мутации у чувашей, либо является результатом компаундного носительства мутаций данного гена со второй не идентифицированной мутацией. У родителей данная мутация не обнаружена.

ДНК-диагностика показала, что доминантное наследование среди больных гипотрихозом 1 типа, предполагающее 50% риск повторного рождения детей с гипотрихозом, является результатом браков между гомозиготными и гетерозиготными носителями делеции 4 экзона гена LIPH. В этих семьях риск повторного рождения составляет 50%. Доминантное наследование в 2 семьях с гипотрихозом 2 типа возможно имеет те же причины, но по другой мутации или гену. Родословные семей с предполагаемым ранее аутосомно-доминантным наследованием гипотрихоза 1 типа представлены на рис.9 и 10. Результаты ДНК-диагностики меняют наши представления.

I 3 7


2 1


Рис. 9. Родословная семьи Ф. с псевдодоминантным наследованием гипотрихоза.




3 2



Рис. 10. Семья Н. с псевдодоминантным наследованием гипотрихоза.

Частота гена LIPH среди здорового населения

различных этнических групп России.

Для выяснения популяционной частоты делеции 4 экзона гена LIPH нами исследовано гетерозиготное носительство среди здоровых индивидов чувашской национальности. В Республике Чувашия проведен скрининг 386 здоровых чувашей на носительство делеции 4 экзона гена LIPH, который показал частоту гетерозиготных носителей и частоту данного мутационного изменения. Также были проанализированы здоровые доноры других национальностей: марийцы, удмурты, башкиры и русские (табл. 5 и рис. 11). В рассмотрение взяты примерно равные выборки (не менее 200 доноров) из разных этнических групп, учитывающие субэтническое деление этносов.

Таблица 5. Частота гена LIPH среди здорового населения различных этнических групп России

Популяция Число образцов крови от здоровых индивидов/хромосом Число гетерозиготных носителей Частота гетерозиготных носителей Частота гена
Чуваши 386/772 21 0,054 0,027
Марийцы 311/622 11 0,035 0,0177
Удмурты 226/452 2 0,0088 0,0044
Башкиры 321/642 2 0,00623 0,0031
Русские 405/810 0 0 0
Всего 1328/3298 36

Рис 11. Частота делеции 4 экзона гена LIPH среди здорового населения в четырех этнических группах. Указано число обследованных хромосом в каждой этнической группе.

На основании данного анализа получена частота гипотрихоза 1 типа, обусловленного делецией 4 экзона гена LIPH, у различных этнических групп: среди чувашей она составила 1:1350; среди марийцев 1:2746, среди удмуртов 1:51020, среди башкир 1:103092. Мы видим, что наибольшая частота заболевания характерна для чувашей, почти в два раза реже встречаемость гипотрихоза 1 типа среди марийцев.

Нельзя не отметить, что гипотрихоз не единственное заболевание, обнаружившее накопление среди чувашей и марийцев. К заболеваниям, часто встречающимся среди чувашей и марийцев, кроме гипотрихоза относятся летальный инфантильный остеопетроз (частота 1:3900 новорожденных у чувашей и 1:14084 у марийцев) и эритроцитоз (частота 1:3879 новорожденных у чувашей и 1:13150 у марийцев и 1:44600 у удмуртов) [Вассерман Н.Н., 2007; Близнец Е.А. и др., 2006; Кириллов А.Г. и др., 2007; Зинченко Р.А. и др., 2007]. Все эти три заболевания либо редко, либо вообще не выявляются среди других этнических групп как России, так и мира.

Такое генетическое сходство чувашей и марийцев неслучайно. На основании многочисленных исторических, культурных и языковых данных большинство исследователей признает чувашей потомками болгарских и суварских племен, появившихся на Средней Волге в VII-VIII вв. [Дмитриев В.Д., 2004, Иванов В.П., 2005]. Заселение чувашского края болгаро-суварами интенсивно шло до середины XIV века с одновременным оттеснением местного марийского населения и смешения с ним. Соотношение этих компонентов при возникновении чувашей остается неясным. Прародина местного чувашского населения, государство Волжская Булгария, процветала вплоть до ХIII века, когда в результате нашествия татаро–монгол и эпидемии чумы не менее 4/5 его народа было уничтожено, а само государство прекратило свое существование.

Таким образом, генофонд оставшегося булгарского населения лег в основу современного чувашского этноса. По литературным данным на начало ХV века, т.е. спустя 6 поколений, насчитывалось около 100 тыс. чувашей [Дмитриев В.Д., 2004]. Можно предположить, что к началу 13 века, после происшедших событий, оставалось около 40-50 тыс. прачувашей. До середины ХХ века 90% чувашей проживало в сельской местности, сохраняя традиционную культуру и положительную этническую брачную ассортативность. В такой ситуации возможен эффект "горлышка бутылки", который мог явиться причиной столь высокого накопления характерных именно для чувашей и рядом проживающих марийцев наследственных заболеваний. Одновременно с увеличение частот отдельных заболеваний у этих народов отмечено снижение частоты частых для русского и европейского населения таких наследственных заболеваний, как фенилкетонурия и муковисциоз (частота в среднем составляет 1:25-30000 новорожденных).

Можно придти к еще одному предварительному заключению, анализируя генетическое сходство чувашей и марийцев. По-видимому, булгары, вторгшиеся на земли, занятые марийцами, представляли собой генетически довольно однородное племя. Происходило более интенсивное смешение этих двух народов, чем общеизвестно в литературе, что привело к накоплению ряда редкой для других этносов и популяций наследственной патологии, в частности гипотрихоза. В последнем случае, трудно было бы ожидать столь небольшую генетическую дифференциацию как внутри марийцев, так и внутри чувашей, а также при сравнении этих двух этнографических групп между собой.

Генетико-эпидемиологическое изучение

гипотрихоза 1 типа, обусловленного делецией 4 экзона гена LIPH

Среди всех больных гипотрихозом 1 типа 56% составили дети. Именно в детском возрасте эта патология так заметна и вызывает беспокойство у родителей, что служит поводом для обращения к врачу в надежде на коррекцию дефекта. В связи с отсутствием эффективного лечения с возрастом пациенты перестают обращаться к врачу; женщины надевают парики и «растворяются в толпе», мужчины коротко стригутся или бреются и тоже исчезают из виду.

Кроме того, в городах республики мы с уверенностью можем констатировать неполный сбор информации о больных с гипотрихозом разных возрастных групп, что связано с легким течением заболевания (больные не имеют инвалидности) и плохой информированностью врачей о пациентах своего участка.

По результатам генетико-эпидемиологического исследования частота гипотрихоза среди детей-чувашей составила 1:2857. Полученная нами частота отличается почти в два раза от ожидаемой частоты, рассчитанной нами через молекулярно-генетический анализ гена LIPH среди здорового населения – 1:1350, что возможно связано с вышеперечисленными причинами. Кроме того, значения распространенности всегда ниже, чем частота заболевания.

В исследовании эпидемиологии гипотрихоза 1 типа, обусловленного делецией 4 экзона гена LIPH, кроме изучения его распространенности, определенный интерес представляет изучение мест рождения предков больных, т.к. в изучении эпидемиологии аутосомно-рецессивных форм наследственных заболеваний большую значимость имеет не столько географическое место проживания больных, сколько географическое место происхождения их родителей, бабушек и дедушек.

Как было сказано ранее этнографически выделяют три группы чувашей: верховые (вирьялы), низовые (анатри) и средненизовые (анат-енчи) [Каховский В.Ф., 2003].

Верховые чуваши проживают в Аликовском, Вурнарском, Красноармейском, Красночетайском, Моргаушском, Чебоксарском, Шумерлинском, Ядринском районах; средненизовые – в Цивильском, Марпосадском, Козловском районах, частично – в Урмарском районе; собственно низовые – в Алатырском, Батыревском, Ибресинском, Канашском, Комсомольском, Урмарском, Шемуршинском, Яльчикском, Янтиковском районах.

Выявленные в нашем случае при расчете распространенности гипотрихоза 1 типа районы с высокой распространенностью (Козловский и Марпосадский) относятся к группе средне-низовых чувашей (анат-енчи). Для определения достоверности различий между распространенностью больных в различных субэтнических группах проведен анализ территориального распространения согласно Животовскому [Животовский Л.А., 1991] (табл.14).

Таблица 14. Распределение больных гипотрихозом, их родителей, бабушек и дедушек по этнографическим группам чувашей

Этнографическая группа Численность по сельским районам Количество больных/ распростр. Количество родителей/ распростр. Количество бабушек и дедушек/ распростр.
Верховые 235062 20/0,85±0,19 32/1,36±,024 51/2,16±0,30
Средненизовые 102628 19/1,85±0,42 29/2,85±0,52 50/4,87±0,69
Низовые 174428 26/1,49±0,29 29/1,66±0,0,31 50/2,86±0,41

Дифференциация между распространенностью больных в различных субэтнических группах выявлена между верховыми и средненизовыми (t=2,17) чувашами. В группах "верховые-низовые" и "средненизовые-низовые" различий не выявлено (t=1,85 и t=0,71, соответственно). В исследованиях, посвященных эпидемиологии большого числа наследственных болезней на территории Республики Чувашия было показано, что различия в значениях распространенности наследственной патологии между районами Республики Чувашия являются результатом действия дрейфа генов и генетической подразделенности [Зинченко С.П. и др., 2007]. Наибольший инбриндинг, достигающий почти 1% зарегистрирован у средненизовых чувашей. В этой же группе выявлено наибольшее количество наследственных заболеваний, обнаруживших локальное накопление. Мы можем только предположить ситуацию, которая привела к данному факту. Известно, что группа средненизовых чувашей сформировалась первой из пришлых болгаро-чувашей и испытала меньшее влияние со стороны соседних этносов (марийцы, татары, мордва). Однако наличие данного мутационного изменения среди чувашей других этнографических групп позволяет сделать заключение, что происхождение мутации произошло в раннем этногенезе чувашей до формирования отдельных этнических групп.

Нами разработан алгоритм (рис. 12) обследования пациентов с врожденным гипотрихозом, который может использоваться врачами-дерматовенерологами, генетиками, педиатрами и терапевтами.

Рис. 12. Алгоритм обследования больных с различными типами гипотрихоз.

В семьях больных проведено медико–генетическое консультирование. Разъяснен диагноз, причины, прогноз потомства. Обсужден вопрос о возможности проведения пренатальной диагностики.

Данные исследования в виде методических рекомендаций изложены перед врачами республики: педиатрами, терапевтами, дерматовенерологами. Заложена основа совместной работы по выявлению и консультированию таких больных.


  1. На территории Республики Чувашия выявлена группа семей с врожденным изолированным рецессивным гипотрихозом. Все больные по национальности чуваши. Сегрегационным анализом в семьях подтвержден аутосомно-рецессивный тип наследования.
  2. Проведение полного клинико-лабораторного обследования соматического статуса и исследования волос пациентов позволило классифицировать выявленную патологию как изолированный наследственный гипотрихоз и выделить 2 клинически различающихся типа гипотрихоза: тип 1 и 2. Для гипотрихоза 1 типа (84% больных) характерно нарушение цикла роста волос (большинство в стадии телогена), структурные изменения стержня, дистрофические изменения кутикулы, нарушение дифференцировки кератиноцитов на уровне фолликулов. При гипотрихозе 2 типа (16% больных) структурные и циклические изменения волос менее выражены. Поражение волос лица и тела одинаковое у больных с различными типами гипотрихоза.
  3. На семьях больных выполнено картирование и идентификация гена LIPH, ответственного за развитие гипотрихоза 1 типа. Обнаружена мутация – делеция 4 экзона гена LIPH (985 п.н.). В гомозиготном состоянии она найдена у всех больных гипотрихозом 1 типа, в гетерозиготном состоянии у их родителей. Исследование больных гипотрихозом 2 типа и их родителей на носительство делеции 4 экзона гена LIPH не показало наличие этого мутационного изменения.
  4. Проведена оценка частоты делеции 4 экзона гена LIPH среди здорового населения различных этнических групп России, которая составила 2,72% у чувашей, 1,76% у марийцев, 0,44% у удмуртов и 0,31% у башкир. Частота гипотрихоза 1 типа, обусловленного делецией 4 экзона гена LIPH, должна составлять среди чувашей 1:1350, среди марийцев 1:2746, среди удмуртов 1:51020, среди башкир 1:103092.
  5. Распространенность гипотрихоза 1 типа, оцененная на детское чувашское население республики, составила 1:2857. Анализ мест рождения больных, их родителей, бабушек и дедушек показал статистически достоверно большее распространение гипотрихоза 1 типа у средне-низовых чувашей. Эта группа в процессе этногенеза сформировалась первой с меньшим влиянием соседних этнических групп; для нее характерен наибольший (почти 1%) инбридинг среди чувашей.
  6. На основании клинико-лабораторного и инструментального обследования больных разработаны дифференциально-диагностические критерии и алгоритм обследования, позволяющие диагностировать различные формы изолированного наследственного гипотрихоза на территории Республики Чувашия. Создана основа для регионального регистра и мониторинга больных наследственным гипотрихозом.


  1. Врачам-дерматологам, педиатрам, терапевтам рекомендуется направлять пациентов с клиническими проявлениями гипотрихоза в МГК для обследования больных и совместного уточнения диагноза (гипотрихоз 1 и 2 типа) с учетом предложенного алгоритма.
  2. Учитывая высокую распространенность в Республике Чувашия наследственного гипотрихоза 1 типа, связанного с del 4 ex гена LIPH, и высокую частоту гетерозиготного носительства данной мутации среди чувашей, всем пациентам с изолированным наследственным гипотрихозом в Республике Чувашия рекомендуется ДНК-диагностика для уточнения диагноза и прогноза потомства.


  1. Абрукова А.В., Ельчинова Г.И., Зинченко Р.А. Индекс Кроу в Республике Чувашия / V Съезд Медицинских генетиков, Уфа, май 2005 // Медицинская генетика. – 2005. – Т.4, №4. – С.145.
  2. Ельчинова Г.И., Зинченко Р.А., Кириллов А.Г., Абрукова А.В., Гинтер Е.К. Анализ репродуктивных параметров городского и сельского населения Чувашии // Генетика. – 2005. – Т.41, №6. – С.850-854.
  3. Зинченко Р.А., Абрукова А.В., Кириллов А.Г., Гинтер Е.К. Наследственный рецессивный гипотрихоз / Генетическая структура и наследственные болезни чувашской популяции / Коллективная монография под ред. Е.К.Гинтера, Р.А.Зинченко. // Чебоксары: издательский дом «Пегас». – 2006. – С.158-166.
  4. Близнец Е.А., Тверская С.М., Зинченко Р.А., Абрукова А.В., Гинтер Е.К., Поляков А.В. Экспрессионный анализ мутации с.807+5ga в гене TCIRG1, ответственной за остеопетроз в Чувашии // Медицинская генетика. – 2006. – Т.5, №4 (46). – С. 22-26.
  5. Абрукова А.В. Наследственный рецессивный гипотрихоз в Чувашии // V Росс. Конгресс «Современные технологии в педиатрии и детской хирургии». Москва, октябрь, 2006. – С. 46.
  6. Kazantseva, A. Goltsov, R. Zinchenko, A.P. Grigorenko, A.V. Abrukova, Y.K. Moliaka, A.G. Kirillov, Z. Guo, S. Lyle, E.K. Ginter, E.I. Rogaev. Human Hair Growth Deficiency Is Linked to a Genetic Defect in the Phospholipase Gene LIPH// Science. – 2006. Nov.110. 314(5801). – P.982-985
  7. Кириллов А.Г., Зинченко С.П., Абрукова А.В., Зинченко Р.А., Ельчинова Г.И., Поляков А.В., Гинтер Е.К. Наследственные болезни среди чувашей Республики Чувашия // Медицинская генетика. – 2007. – Т.6, №1(55). – С. 19-27.
  8. Зинченко Р.А., Ельчинова Г.И., Барышникова Н.В., Кириллов А.Г., Абрукова А.В., Петрова Н.В., Тимковская Е.Е., Зинченко С.П., Шокарев Р.А., Морозова А.А., Близнец Е.А., Вассерман Н.Н., Степанова А.А., Поляков А.В., Гинтер Е.К. Дифференциация этнических групп России по генам наследственных болезней // Медицинская генетика. – 2007. – Т.6, №2 (56). – С. 29-37
  9. Зинченко С.П., Кириллов А.Г., Абрукова А.В., Сорокина Т.В., Шаронова Е.И., Хидиятова И.М., Джемилева Л.У., Шокарев Р.А., Близнец Е.А., Хуснутдинова Э.К., Зинченко Р.А., Гинтер Е.К. Эпидемиология наследственной тугоухости в российских популяциях // Медицинская генетика. – 2007. – Т.6, №5 (59). – С. 19-29.



2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.