Инсерционная инактивация оперона вирулентности бактерий bordetella pertussis в диагностике типичных и атипичных форм коклюша

На правах рукописи

Медкова Алиса Юрьевна

Инсерционная инактивация оперона вирулентности бактерий

Bordetella pertussis в диагностике типичных и атипичных форм коклюша

03.02.03 – микробиология

14.01.09 – инфекционные болезни


диссертации на соискание ученой степени

кандидата медицинских наук



Работа выполнена в Федеральном государственном бюджетном учреждении «Научно-исследовательский институт эпидемиологии и микробиологии имени почетного академика Н.Ф. Гамалеи» Министерства здравоохранения Российской Федерации

Научные руководители:

Доктор биологических наук Каратаев Геннадий Иванович

Доктор медицинских наук,

профессор Боковой Александр Григорьевич

Официальные оппоненты:

Доктор медицинских наук,

заведующий лабораторией

молекулярных основ патогенности

ФГБУ «НИИЭМ им. Н.Ф. Гамалеи»

МЗ РФ Белый Юрий Федорович

Доктор медицинских наук, профессор,

заведующая кафедрой инфекционных

болезней у детей №2 педиатрического

факультета ГБОУ ВПО РНИМУ

им. Н.И. Пирогова

МЗ РФ Шамшева Ольга Васильевна

Ведущая организация: Федеральное бюджетное учреждение науки «Московский научно-исследовательский институт эпидемиологии и микробиологии им. Г.Н. Габричевского» Роспотребнадзора

Защита диссертации состоится «22» февраля 2013 г. в 11 часов на заседании диссертационного совета Д 208.130.01 в НИИЭМ им. Н.Ф. Гамалеи Министерства здравоохранения РФ по адресу:

123098, г. Москва, ул. Гамалеи, д. 18.

С диссертацией можно ознакомиться в научной библиотеке НИИЭМ им. Н.Ф. Гамалеи Министерства здравоохранения РФ

Автореферат разослан «21» января 2013 г.

Ученый секретарь

диссертационного совета,

доктор медицинских наук, профессор Русакова Е.В.


Актуальность проблемы. Коклюш – инфекционное респираторное заболевание человека, вызываемое грамотрицательными бактериями Bordetella pertussis, характеризующееся тяжелым течением и высокой летальностью у новорожденных и детей первого года жизни. Летальность при коклюше обусловлена развитием осложнений: апноэ, нарушения мозгового кровообращения, кровотечения из задне-глоточного пространства и бронхов, внутричерепные кровоизлияния, надрывы диафрагмы, коклюшная пневмония, эмфизема легких и др. Массовая противококлюшная вакцинация, проводимая в нашей стране с помощью АКДС-вакцины, начиная с 1950-х гг. прошлого столетия, значительно снизила летальность и заболеваемость коклюшем в типичной форме (Захарова М.С., 1969, Сигаева Л.А, 1986, Озерецковский Н.А., 2004). Несмотря на клиническую и лабораторную гиподиагностику коклюша, по данным ВОЗ, ежегодно в мире регистрируется до 50 миллионов случаев заболевания, умирает около 300 тысяч детей, преимущественно в возрасте до 1 года (WHO, 2003). В последние десятилетия во всем мире наблюдается рост заболеваемости коклюшем среди подростков и взрослых (Cherry J.D. et al., 2004, Отвагин С.А., 2005, Тимченко В.Н., 2009). Типичную клиническую картину коклюша наблюдают сегодня все реже, в основном, у не вакцинированных, наиболее восприимчивых к коклюшной инфекции младенцев до 5-6 месяцев и у детей старше 10 лет (Wood N. et al., 2008). Увеличивается число случаев атипичных форм коклюша: стертых, бессимптомных, абортивных, транзиторного бактерионосительства (Лобзин Ю.В., 2011). Эпидемиологические исследования подтвердили, что для восприимчивой группы детей источником инфекции являются подростки и взрослые, у которых коклюш, как правило, протекает в атипичных формах. Носителями возбудителя коклюша могут быть практически здоровые люди (Герасимова А.Г., 2004, Heininger U., 2004, Mattoo S., 2005).

Диагностика атипичных форм коклюша затруднена из-за отсутствия характерной клинической картины и адекватных лабораторных методов. Бактериологический метод на ранних стадиях коклюша выявляет возбудитель не более чем в 10% случаев даже при типичных формах заболевания (Борисова О.Ю., 2010), серологические методы (РНГА, РПГА, ИФА) подтверждают заболевание только на поздних стадиях, а нарастания титров специфических антител у бактерионосителей, как правило, не наблюдается (Ценева Г.Я., 2003). Раннее лабораторное подтверждение диагноза «Коклюш» особенно актуально в клинической практике для диагностики атипичных форм, определения тактики лечения и проведения противоэпидемических мероприятий в семейных очагах и организованных детских коллективах (Сипачева Н.Б., 2011).

Бактерии Bordetella pertussis – микроорганизмы, обладающие значительной изменчивостью, проявляющейся в появлении бактерий разной степени вирулентности. Это зависит от условий культивирования, длительности заболевания, лечения, ранее проведенной вакцинации (Friedrich M.J., 2011). Впервые на изменчивость B.pertussis in vivo было указано еще Трушиной-Тумановой Е.Ф. в 1949 г., выделившей непосредственно от 39 больных с различной клинической картиной коклюша 40 атипичных культур B.pertussis. Экспрессия генов вирулентности бактерий B.pertussis контролируется опероном вирулентности bvgAS. B.pertussis в I фазе (Вvg+) экспрессируют все факторы вирулентности. В результате мутаций, нарушающих структуру оперона bvgAS, происходит переход из I вирулентной фазы в IV авирулентную (Вvg–) фазу и изменение экспрессии факторов вирулентности (фазовые модуляции). Частичная потеря вирулентности наблюдается у B.pertussis во II и III фазах вирулентности, объединенных в понятие промежуточной фазы (Вvgi) (Tracy L. Nicholson et al., 2012).

Исследования по изучению регуляции генов вирулентности возбудителя коклюша, проводимые в ФГБУ НИИЭМ им. Н.Ф. Гамалеи МЗ РФ, показали, что перемещение инсерционных последовательностей (IS-элементов 481 и 1002) в оперон bvgAS является одним из механизмов, обеспечивающих переход бактерий B.pertussis из вирулентной I фазы в авирулентную IV фазу. Популяции бактерий B.pertussis in vitro были гетерогенны и содержали разное, зависящее от условий культивирования, количество вирулентных Вvg+ бактерий и авирулентных инсерционных Вvg– мутантов. Соотношение между числом вирулентных и авирулентных бактерий было названо фазовым составом популяции бактерий B.pertussis (Каратаев Г.И., 2008). Вероятно, in vivo с течением инфекционного процесса происходит накопление авирулентных инсерционных мутантов возбудителя коклюша и формирование бактерионосительства.

Разработка метода быстрой идентификации возбудителя коклюша и определения фазового состава популяции бактерий B.pertussis поможет улучшить диагностику атипичных форм коклюша. Установление корреляции между фазовым составом популяции бактерий B.pertussis и клинической картиной заболевания позволит определить тактику лечения и проведения противоэпидемических мероприятий.

Цель работы: регистрация инсерционных авирулентных Bvg– мутантов бактерий B.pertussis in vivo и выявление корреляции между клинической картиной заболевания у больных типичными и атипичными формами коклюша и фазовым составом популяции возбудителя.

Для достижения поставленной цели были решены следующие задачи:

  1. Разработка тест-системы ПЦР в режиме реального времени (ПЦР-РВ) для количественного определения ДНК бактерий B.pertussis в клинических образцах, содержащих инсерции IS481 и IS1002 в опероне вирулентности bvgAS.
  2. Выявление бактерий B.pertussis с помощью ПЦР-РВ в сравнении с бактериологическим методом в назофарингеальных мазках от больных типичными и атипичными формами коклюша и практически здоровых детей и взрослых, контактировавших и не контактировавших с больными.
  3. Количественное определение авирулентных бактерий B.pertussis, содержащих инсерциии IS481 и IS1002 в опероне bvgAS в ПЦР-РВ положительных клинических образцах.
  4. Установление корреляции между клинической картиной заболевания у больных типичными и атипичными формами коклюша и фазовым составом популяции бактерий B.pertussis.
  5. Изучение сроков персистенции и фазового состава популяции бактерий B.pertussis разработанным методом ПЦР-РВ при экспериментальном заражении мышей вирулентными бактериями B.pertussis.

Научная новизна. Впервые разработан неинвазивный количественный метод для выявления возбудителя коклюша и его инсерционных авирулентных (Bvg–) мутантов для изучения фазового состава популяции бактерий B.pertussis у больных типичными и атипичными формами заболевания.

Впервые показано, что популяции бактерий B.pertussis у больных различными формами коклюша гетерогенна, установлена корреляция между её фазовым составом и клинической картиной заболевания: абсолютное большинство бактерий B.pertussis у больных типичными формами коклюша содержит интактный оперон вирулентности (I фаза, Bvg+), тогда как у больных атипичными формами коклюша – в среднем 0,2% инсерционных авирулентных Вvg– мутантов, у бактерионосителей – от 10 до 90%.

Впервые показано, что ДНК возбудителя коклюша выявляется у 55,6% больных с диагнозом «ОРВИ» и смешанными респираторными инфекциями, у 31% больных – с симптомом «длительный кашель».

ДНК B.pertussis была выявлена у 75% «практически здоровых» детей и взрослых, контактировавших с больными.

Научно-практическая значимость работы. Разработанная тест-система ПЦР-РВ предназначена для дифференциальной диагностики респираторных инфекций, трудно поддающихся этиотропной терапии, в комплексе с общепринятыми методами диагностики коклюша (бактериологическому и серологическому).

С помощью созданной тест-системы ПЦР-РВ будет возможно проведение развернутых эпидемиологических обследований для изучения сроков персистенции бактерий и проведения адекватных санитарных мероприятий (карантина и т.д.).

Использование тест-системы ПЦР-РВ необходимо для оценки эффективности коклюшных вакцин, совершенствования и разработки новых профилактических препаратов, а также в фундаментальных научно-исследовательских работах, направленных на дальнейшее изучение механизмов образования персистирующих форм бактерий.

По результатам работы подготовлены Методические рекомендации «Способ выявления авирулентных бактерий Bordetella pertussis, сформированных в результате инсерций IS-элементов 481 и 1002 в оперон вирулентности bvgAS, у больных атипичными формами коклюша», утвержденные Советом по внедрению научных достижений в практику ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России 22 ноября 2012 г., протокол № 22.

Основные положения, выносимые на защиту:

  1. Разработана тест-система ПЦР-РВ, позволяющая в клинических образцах выявлять бактерии возбудителя коклюша и изучать фазовый состав популяции бактерий Bordetella pertussis у больных типичными и атипичными формами коклюша.
  2. С помощью разработанной тест-системы ПЦР-РВ показана широкая распространенность возбудителя коклюша среди больных с инфекционной респираторной патологией, а также возможность носительства бактерий B.pertussis практически здоровыми людьми.
  3. Установлена корреляция между клинической картиной коклюша у больных типичными и атипичными формами и фазовым составом популяции бактерий B.pertussis.
  4. Разработанный способ выявления авирулентных инсерционных мутантов B.pertussis позволяет изучать механизмы изменения популяции возбудителя коклюша в процессе развития инфекционного процесса.

Апробация работы. Результаты работы доложены на Международной научной конференции студентов, аспирантов и молодых ученых «Ломоносов-2008», 3-е место (Москва), на научно-практической конференции Научного Центра Здоровья Детей РАМН «Актуальные проблемы педиатрии» в рамках конкурса молодых ученых (Москва, 2009), на Международной школе по молекулярной генетике «Геномика и биология клетки» (Звенигород, 2010), на XIV Всероссийском научном форуме «Дни иммунологии в Санкт-Петербурге», в рамках конкурса молодых ученых, 1-е место (Санкт-Петербург, 2011), на международной научной конференции «Генетика и биотехнология XXI века: проблемы, достижения, перспективы» (Минск, 2012). Защищена дипломная работа на факультете фундаментальной медицины Московского Государственного Университета им. М.В. Ломоносова «Диагностическое значение фазовых состояний возбудителя коклюша (Bordetella pertussis), выявляемого в клинических образцах детей и взрослых с диагнозом «ОРЗ» (Москва, 2009).

Апробация работы состоялась 8 июня 2012 г. на совместной научной конференции отдела генетики и молекулярной биологии бактерий и отдела медицинской микробиологии ФГБУ «НИИЭМ им. Н.Ф. Гамалеи» Минздрава России.

Публикации. По теме диссертации опубликовано 8 научных работ, в том числе две статьи в журналах, рекомендованных ВАК, и одна статья – в зарубежном издательстве. По результатам работы подана заявка на получение патента (2011 г).

Объем и структура работы. Диссертация изложена на 105 страницах машинописного текста и включает введение, обзор литературы, описание материалов и методов, собственные исследования, обсуждение результатов исследований, выводы и список использованной литературы, содержащий ссылки на 34 отечественных и 151 иностранный источник. Работа иллюстрирована 15 таблицами и 8 рисунками.


В ходе работы обследовано 157 детей и взрослых, госпитализированных в детское инфекционное отделение ФГБУ ЦКБ с поликлиникой УДП РФ, в инфекционную клиническую больницу №1 г. Москвы, а также направленных на консультацию для уточнения диагноза в ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России: 15 больных с диагнозом «Коклюш, типичная форма», 18 больных с диагнозом «ОРВИ», смешанными вирусно-бактериальными респираторными инфекциями, 26 пациентов с симптомом «длительный кашель», а также 98 практически здоровых детей и взрослых, контактировавших и не контактировавших с больными (таблица. 3). Для лабораторного подтверждения клинического диагноза в стационаре применялись бактериологический, серологический и молекулярно-биологический методы. Диагнозы верифицировали на основании клинико-эпидемиологических и лабораторных данных в соответствии с общепринятой классификацией (МКБ-10).

Для бактериологического посева и ПРЦ-РВ исследования назофарингеальные мазки брали от больных на 3-4-й день госпитализации, до начала специфического антибактериального лечения в соответствии с «Требованиями к взятию и транспортировке материала для лабораторной диагностики коклюша» Комитета Здравоохранения г. Москвы от 25 ноября 2002 года № 539/№ 230 с помощью ватного тампона типа Dacron. Одновременно обследовали матерей по уходу за ребенком и ближайших родственников, контактировавших с больными.

Микробиологическую идентификацию возбудителя коклюша проводили в соответствии с «Инструкцией по отбору, проверке и хранению штаммов B.pertussis для изготовления коклюшной вакцины и коклюшного компонента ассоциированных вакцин» (1987).

Штаммы бактерий, использованные в работе. В работе использованы бактерии из коллекции музея ФГБУ «НИИЭМ им. Н.Ф. Гамалеи» Минздрава России. Бактерии Bordetella ssp. культивировали на плотной питательной среде КУА с добавлением 15% дефибринированной крови барана в течение 3-5 суток, E.coli – на L-агаре, другие бактерии – на соответствующих специфических питательных средах.

Лабораторные животные. Беспородные белые мыши обоего пола, 3-4-х недельного возраста, весом 10-12 г.

Мышей экспериментально заражали живыми вирулентными бактериями B.pertussis 134 I фазы (Bvg+) внутривенно и интраназально по 80 мышей в каждой группе. В хвостовую вену мыши вводили 30 мкл суспензии, содержащей 3х109 МОЕ/мл бактерий B.pertussis. При интраназальном заражении в каждую ноздрю вводили 25 мкл суспензии, содержащей 3х107 МОЕ/мл бактерий B.pertussis. Мышей усыпляли Нембуталом (Синяшин Н.И., 1986). Контрольным мышам (по 24 мыши в каждой группе) вводили стерильный 0,85% раствор хлорида натрия, 25 и 30 мкл интраназально и внутривенно соответственно.

Микробиологическое исследование и выделение ДНК от экспериментально зараженных мышей. У 10 мышей из каждой группы извлекали легкие через 2 и 24 часа, 7-й, 14-й, 28-й, 42-й, 49-й и 63-й дни после заражения. Легкие гомогенизировали в 1 мл 0,85% раствора хлорида натрия (рН 7,2-7,4), инкубировали 15 мин при температуре 350С и центрифугировали при 3000 об/мин 7 мин. Надосадочную жидкость разводили в 100, 10 000 и 1000 000 раз, затем по 0,1 мл из каждого разведения высевали на три чашки Петри с селективной средой КУА, по 500 мкл супернатанта без разведения использовали для выделения ДНК. В каждой точке наблюдения подсчитывали число выросших колоний на всех чашках Петри. Среднее количество КОЕ в легких каждой мыши (М, КОЕ/мл) рассчитывали по формуле:

Для выделения ДНК B.pertussis из клинических образцов и супернатантов гомогенатов легких мышей в соответствии с инструкцией к набору Wizard Genomic DNA Purification System (Promega, США) использовали магнитный сорбент.

ПЦР-РВ проводили на приборе АНК-32ТМ (Россия) с использованием праймеров и зондов, синтезированных ЗАО «Синтол» и «Евроген». Nested-ПЦР – на приборе «Терцик» (Россия).

Секвенирование фрагментов ДНК проводили на приборе 373А Automatic Sequencer (Applied Biosystems, USA) с рекомендуемым набором реактивов.

Статистическая обработка результатов выполнена с помощью программы Microsoft Excel 2007 и статистических методов, принятых в биологии и медицине (Гланц С., 1999).


1. Разработка тест-системы ПЦР-РВ для выявления ДНК возбудителя коклюша и анализа фазового состава популяции бактерий Bordetella pertussis

На первом этапе работы была создана тест-система ПЦР-РВ, позволяющая выявлять ДНК возбудителя коклюша, регистрировать наличие инсерционных последовательностей IS481 и IS1002 в сctagg сайте оперона вирулентности bvgAS B.pertussis и изучать фазовый состав популяции возбудителя. Для анализа фазового состава популяции бактерий B.pertussis рассчитывали значения n481 и n1002 – отношение числа инсерций IS481 и IS1002 (N481 и N1002) в оперон bvgAS к общему количеству ДНК B.pertussis в 5 мкл анализируемого образца (QBp).

Выбор праймеров и зондов. В основу выбора праймеров и зондов для определения количества геном-эквивалентов (ГЭ) ДНК B.pertussis и количества геномов B.pertussis, содержащих интеграции IS481 и IS1002 в cctagg сайте оперона bvgAS, положена схема, представленная на рисунке 1.

Тест-система ПЦР-РВ включает две независимые реакции, протекающие в одной пробирке. Первая реакция позволяет определить количество IS481 (N481) в исследуемом образце ДНК, а вторая – IS1002 (N1002). В первой и второй реакциях использовали праймеры Bp481-42–Bp111, Bp1002-33–Bp111 и зонды R6G-481, ROX-1002 соответственно (таблица 1).

Таблица 1. Последовательности праймеров и зондов, использованные для детекции IS481 и IS1002 и их интеграций в cctagg сайт оперона bvgAS B.pertussis и для конструирования плазмид pIS481 и pIS1002

Праймер/ зонд Последовательность нуклеотидов Примечание*
Bp111 ttcaggcacacaaacttgatgggcg IS481, IS1002
AR acgaggtgcgaggtggtcag bvgAS
Bp2 ttcaggcacacaaacttgatgggcg IS481

* - положение праймеров и зондов изображено на рисунке 1

Условия амплификации приведены в таблице 2. Объем реакционной смеси 25 мкл (ЗАО «Синтол», Россия) содержал 2,5 ед. Hot-Rescue Taq-полимеразы, 2,5 мкл 10-кратного KCl-ПЦР-буфера, по 250 мкМ dNTP, праймеры по 10 pmol и зонды по 5 pmol на одну реакцию, 5 мкл исследуемого образца ДНК B.pertussis.

Таблица 2. Температурно-временной профиль ПЦР-РВ

Температура Время, секунды Количество циклов
95°С 300 1
65°С 50 50
95°С 20 50

Конструирование плазмид pIS481 и pIS1002 для определения количественных характеристик популяции бактерий B.pertussis в реакции ПЦР-РВ. Для построения калибровочных кривых для определения количества ГЭ ДНК B.pertussis и инсерций IS481 и IS1002 в сctagg сайт оперона bvgAS были сконструированы плазмиды рIS1002 и pIS481, включающие фрагменты последовательностей хромосомы B.pertussis, сформированные в результате искомых инсерций.

Рис. 1. Структура фрагмента хромосомы B.pertussis, содержащего инсерцию IS481 или IS1002 в сctagg сайт оперона bvgAS

Для конструирования плазмиды рIS1002 использован фрагмент амплификации хромосомы B.pertussis 54.1, Вvg– мутант, содержащий инсерцию IS1002 в cctagg сайте оперона bvgAS (Sinyashina L.N. et al., 2008), с праймерами SF–AR, для конструирования плазмиды рIS481 – продукт амплификации ДНК B.pertussis Tohama I фазы с праймерами SF–Bp2 (таблица 1). Клонирование проводили с использованием системы pGemT (Promega, США) согласно руководству к её применению. Структуру рекомбинантных плазмид определяли с помощью ПЦР, рестрикции и секвенирования клонированного фрагмента.

По результатам ПЦР-РВ серии разведений pIS481 и рIS1002 с праймерами Bp481-42–Bp111, Bp1002-33–Bp111 и зондами R6G-481, ROX-1002 были построены калибровочные кривые, позволяющие выявлять количество копий IS481 и IS1002 в исследуемом образце (Q481 и Q1002). С помощью построения аналогичных калибровочных кривых ПЦР-РВ с праймерами SF-Bp111 и зондами R6G-481и ROX-1002 определяли количество ДНК B.pertussis, содержащей инсерции IS1002 и IS481 в опероне bvgAS (N481 и N1002).

Количество молекул ДНК B.pertussis, содержащих инсерции IS1002 и IS481 в cctagg сайте оперона bvgAS, было определено как соотношение n481, 1002 = N481, 1002/QBp, где количество ГЭ B.pertussis – QBp рассчитано как среднее значение величин QBp481 = Q481/ 238 и QBp1002 = Q1002/ 6. Числа 238 и 6 соответствуют количеству копий IS481 и IS1002 в секвенированной хромосоме B.pertussis Tohama I фазы (Julian Parkhill et al., 2003).

Чувствительность и специфичность разработанной тест-системы ПЦР-РВ. С помощью ПЦР-РВ серии разведений ДНК B.pertussis 54.1, Tohama I и рIS481 и рIS1002 было установлено, что чувствительность тест-системы составляет одну копию ГЭ ДНК B.pertussis и порядка 10-20 копий последовательностей IS481 и IS1002 в ссtagg сайте оперона. Высокая чувствительность при определении количества ГЭ ДНК B.pertussis объясняется копийностью повторяющихся последовательностей IS481и IS1002 (238 и 6, соответственно), используемой в качестве мишени при постановке ПЦР.

Проверку специфичности выбранных праймеров и зондов проводили в поисковой системе BLAST, а также в ПЦР-РВ на образцах ДНК различных микроорганизмов, в том числе вызывающих респираторные инфекции: B.parapertussis, B.bronchiseptica, Staph.aureus, Staph.epidermidis, Neisseria meningitidis, M.tuberculosis, E.сoli K12, L.pneumophilia, K.pneumoniae, C.diphteriae, S.typhimurium, Sh.sonnei, Sh.flexneri, Y.pseudotuberculosis, Chl.pneumoniae, Myc.pneumoniae, Str.pneumoniae. Результаты анализа ДНК всех перечисленных микроорганизмов с помощью разработанной нами тест-системы ПЦР-РВ не выявили достоверных сигналов амплификации.

Таким образом, нами разработана специфичная и высокочувствительная тест-система ПЦР-РВ, позволяющая выявлять в клинических образцах единичные копии ДНК B.pertussis и 10 ГЭ ДНК B.pertussis, содержащих инсерции IS481 и IS1002 в cctagg сайт оперона bvgAS.

2. Выявление возбудителя коклюша у больных типичными и атипичными формами заболевания и анализ фазового состава популяции бактерий B.pertussis

Для проведения исследования были собраны назофарингеальные мазки от больных с диагнозом: «Коклюш, типичная форма» – 15 образцов, с диагнозом «ОРВИ» и со смешанными вирусно-бактериальными респираторными инфекциями – 18, с симптомом «длительный кашель» – 26, «практически здоровых» детей и взрослых, контактировавших с больными, – 16 и от «практически здоровых» взрослых и детей, не контактировавших с больными, – 82. Образцы были исследованы с помощью бактериологического метода и ПЦР-РВ. Результаты анализа представлены на рисунке 2 и в таблице 3.

Таблица 3. Сравнительные результаты бактериологического метода и ПЦР-РВ по выявлению возбудителя коклюша в клинических образцах

Клинический диагноз Количество образцов Идентификация B.pertussis, бак. метод Идентификация ДНК B.pertussis, ПЦР-РВ
Коклюш 15 6 (40%) 14 (93,3%)
ОРВИ, смешанные респираторные инфекции 18 2 (11,1%) 10 (55,6%)
Длительный кашель 26 2 (7,7%) 8 (31%)
Практически здоровые взрослые и дети, контактировавшие с больными 16 не обнаружено 12 (75%)
Практически здоровые дети и взрослые, не контактировавшие с больными 82 не обнаружено 6 (7,3%)
Общее количество образцов 157 10 50

Из представленных данных видно, что у больных типичными формами коклюша ДНК возбудителя методом ПЦР-РВ выявлена в 93,3% случаев, бактериологическим методом – в 40%. ДНК B.pertussis выявлена у 55,6% больных с диагнозом «ОРВИ» и смешанными вирусно-бактериальными респираторными инфекциями, в то же время бактериологическим методом возбудитель коклюша был обнаружен в 11%. У больных с симптомом «длительный кашель» в 31% случаев – методом ПЦР-РВ, в 7,7% – бактериологическим методом. У практически здоровых детей и взрослых, контактировавших с больными, методом ПЦР-РВ возбудитель коклюша был обнаружен в 75% случаев, в группе не контактировавших с больными – 7,3%. Бактериологическим методом B.pertussis в этой группе не выявлена.

Сравнение результатов бактериологического посева и ПЦР-РВ показало высокую эффективность метода ПЦР-РВ и разработанной нами тест-системы.

Рис. 2. Выявление возбудителя коклюша бактериологическим методом и ПЦР-РВ

По результатам количественного ПЦР-РВ анализа ДНК возбудителя коклюша пациенты были разделены на три группы для изучения фазового состава популяций бактерий B.pertussis.

В первую группу включили 14 пациентов с максимальным количеством ДНК B.pertussis – 106-107 ГЭ в 5 мкл образца. Относительное количество интеграций IS481 и IS1002 составляло в среднем 10-5. Следовательно, абсолютное большинство бактерий в популяции находились в I фазе, вирулентном состоянии (Bvg+). Независимо от возраста и сопутствующих инфекций у больных этой группы наблюдали типичную клиническую картину коклюша (таблица 4).

Во вторую группу отнесли 18 пациентов, в клинических образцах которых зарегистрировано 103 –104 ГЭ ДНК B.pertussis. Частота интеграций IS481 и IS1002 у этих пациентов составила в среднем 10-3 (таблица 4). В этой группе оказались пациенты с диагнозом «ОРВИ», смешанными вирусно-бактериальными респираторными инфекциями, с симптомом «длительный кашель».

Третья группа – 20 пациентов с количеством ДНК B.pertussis в образцах от нескольких десятков до нескольких сотен ГЭ – практически здоровые дети и взрослые, контактировавшие и не контактировавшие с больными. Частота регистрации инсерционных авируленных Bvg– мутантов в этой группе достигала 90% (таблица 4).

Таблица 4. Анализ фазового состава популяций бактерий B.pertussis

Клинический диагноз, число обследованных больных Количество ДНК B.pertussis Относительное количество интеграций (n)
n481 n1002
Коклюш, типичные формы, n=14 (5,6±1,6)*106 (4,8±4,4)*10-5 (7,1±6,2)*10-6
ОРВИ, смешанные респираторные инфекции, длительный кашель, n=18 (9,7±2,7)*103 (1,6±1,5)*10-3 (1,4±1,3)*10-4
Практически здоровые, контактировавшие и не контактировавшие с больными, n=20 (1,3±0,9)*102 0,5±0,4 0,4±0,4

Для подтверждения того, что регистрируемые нами продукты ПЦР действительно представляют собой структуры, сформированные в результате интеграции IS-элементов в cсtagg сайт оперона bvgAS, проведено секвенирование продуктов амплификации 3-х образцов ДНК, в которых в 5 мкл было выявлено 10-30 инсерций IS-элементов.

Продукты амплификации для секвенирования получены в результате постановки nested-ПЦР: первая ПЦР с праймерами SF-Bp2, вторая – с праймерами SF-Bp111 (рис. 1). Определённая последовательность полностью совпадала с ожидаемой, сформированной в результате интеграции IS481 в cctagg сайт оперона bvgAS. Не было обнаружено каких-либо изменений ни в последовательности IS-элемента, ни в прилегающей последовательности оперона bvgAS.

Таким образом, с помощью разработанной тест-системы ПЦР-РВ впервые получены лабораторно подтвержденные данные о значительной распространенности атипичных форм коклюша у больных ОРВИ и смешанными респираторными инфекциями, носительстве возбудителя коклюша практически здоровыми людьми.

Анализ фазового состава показал гетерогенность популяций бактерий B.pertussis у обследованных пациентов. У больных типичными формами коклюша бактерии B.pertussis находились в I фазе и содержали интактный оперон вирулентности (Bvg+). Популяции бактерий B.pertussis у больных атипичными формами коклюша содержали в среднем 0,2% инсерционных авирулентных Вvg– мутантов, у практически здоровых бактерионосителей их количество составляло от 10 до 90%.

Организационные сложности, возникающие при длительном наблюдении и повторном обследовании больных, не позволяют изучать фазовый состав популяции возбудителя коклюша, накопление авирулентных инсерционных Bvg– мутантов B.pertussis с течением инфекционного процесса и формирование бактерионосительства. В связи с этим нами было предпринято изучение сроков персистенции и фазового состава популяции бактерий B.pertussis с помощью разработанной тест-системы ПЦР-РВ при экспериментальном заражении мышей.

3. Изучение сроков персистенции и фазового состава популяции бактерий B.pertussis при экспериментальном заражении мышей

Лабораторные мыши являются общепринятой моделью для изучения степени вирулентности бактерий B.pertussis, токсичности и безвредности коклюшных вакцин для переноса результатов экспериментов in vivo непосредственно на людей.

Для изучения сроков персистенции возбудителя коклюша и накопления инсерционных авирулентных мутантов B.pertussis в процессе развития инфекционного процесса экспериментально инфицировали вирулентными бактериями B.pertussis 134 беспородных белых мышей.

Для идентификации возбудителя коклюша и анализа фазового состава бактерий B.pertussis в гомогенатах легких мышей использовали те же методы, что и при изучении клинических образцов.

Определение сроков персистенции бактерий B.pertussis при экспериментальном заражении мышей.

Внутривенно и интраназально заражали по 80 мышей. В каждой группе было по 24 контрольные мыши, которым вводился стерильный 0,85% раствор хлорида натрия.

Идентификацию возбудителя коклюша в легких зараженных (10 мышей из каждой группы) и контрольных (3 мыши из каждой группы) животных проводили с помощью бактериологического метода путем посева супернатантов гомогенатов легких на среду КУА через 2 и 24 часа, 7-й, 14-й, 28-й, 42-й, 49-й и 63-й дни после заражения.

Независимо от способа инфицирования при посеве на селективную среду КУА супернатантов гомогенатов легких мышей максимальное число КОЕ наблюдали до 14-ого дня после заражения. На 28-й день регистрировались единичные колонии (рис. 3).

 Обнаружение B.pertussis 134 бактериологическим методом в легких мышей-2

Рис. 3. Обнаружение B.pertussis 134 бактериологическим методом в легких мышей после внутривенного и интраназального заражения

Результаты средних значений М – количества КОЕ в 1 мл гомогенатов легких 10 мышей в каждой группе, рассчитанных по формуле, рекомендованной ВОЗ для подсчета КОЕ B.pertussis в легких зараженных мышей, – представлены в таблице 5.

Таблица 5. Сравнительное выявление бактерий B.pertussis в легких мышей бактериологическим методом и ПЦР-РВ при экспериментальном заражении

Срок наблю-дения Бактериологический посев, КОЕ/мл, n=10 ПЦР-РВ, количество ГЭ ДНК B.pertussis, n=10
в/в* и/н** в/в и/н
2 часа роста нет (4±0,4)*103 н/о (3,7±1,3)*102
24 часа роста нет (2,6±0,4)*103 (1,1±0,25) *102 (8,5±1,2)*102
7 день (2,8±0,5)*103 (3±0,9)*103 (3,7±5,7)*103 (1,5±0,8)*108
14 день (2,5±0,2)*104 (2,6±0,2)*104 (6,5±4,4)*105 (1,4±0,8)*106
28 день (8,2±1,02)*103 (4,9±1,54)*103 (4,9±7,7)*104 (5,2±2,7)*103
42 день роста нет роста нет (8,7±5,2)*103 (9,7±4,2)*103
49 день роста нет роста нет (1,9±1,2)*103 (4,2±2,3)*103
63 день роста нет роста нет (5,3±1,9)*102 (3,4±2,1)*102

* внутривенное заражение

** интраназальное заражение

роста нет – не обнаружен рост B.pertussis как при посеве разведений супернатантов гомогенатов легких, так и без разведения

н/о – не обнаружено

В легких контрольных мышей бактерии B.pertussis 134 не были обнаружены ни бактериологическим методом, ни ПЦР-РВ.

Результаты определения количества ГЭ ДНК бактерий B.pertussis в легких мышей на разных сроках после внутривенного и интраназального заражения B.pertussis 134 представлены на рисунке 4. Точки на графике соответствуют количеству геном-эквивалентов в 5 мкл образца ДНК B.pertussis, определенному как среднее значение этого показателя у десяти мышей (таблица 5).

 Динамика изменения содержания ГЭ ДНК B.pertussis в легких мышей после-3

Рис. 4. Динамика изменения содержания ГЭ ДНК B.pertussis в легких мышей после экспериментального заражения

Максимальное количество ДНК B.pertussis, независимо от способа заражения, было зарегистрировано в лёгких мышей на 7 и 14 дни, а затем снижалось с течением инфекционного процесса, что соответствовало срокам развития заболевания у людей в типичной форме (рис. 4). ДНК B.pertussis выявляли с помощью разработанной тест-системы ПЦР-РВ в легких мышей до 63 дня после заражения (срок наблюдения). Таким образом, с помощью разработанной тест-системы ПЦР-РВ бактерии B.pertussis выявляли в легких мышей до 63-го дня наблюдения, и, возможно, эти сроки переживания возбудителя коклюша у животных соответствуют времени персистенции бактерий в организме человека, более длительного, чем установлено карантином – 21 день.

Изучение фазового состава популяции бактерий B.pertussis в легких мышей при экспериментальном инфекционном процессе

В каждой точке наблюдения определяли фазовый состав популяции бактерий B.pertussis. Для этого в ДНК B.pertussis, выделенной из легких инфицированных мышей, с помощью разработанной нами тест-системы ПЦР-РВ определяли количество интеграций IS481 и IS1002 в опероне bvgAS. Результаты эксперимента представлены на рис 5. По оси ординат отложены значения десятичного логарифма n (lg n), где n=N481/QBp.

Рис. 5. Динамика накопления авирулентных (Bvg-) инсерционных мутантов B.pertussis 134 в легких мышей при экспериментальном инфекционном процессе

Через 2 и 24 часа после интраназального и внутривенного заражения вирулентным штаммом B.pertussis только 10-5–10-6 бактерий содержали интеграции IS481 или IS1002 в опероне вирулентности bvgAS. При обоих способах заражения относительное число авирулентных мутантов B.pertussis в анализируемой популяции нарастает, начиная с 7-ого дня, и достигает к 63-му дню 50% от общего объёма бактериальной популяции (рис. 5). Достоверность определения параметров популяции не вызывала сомнения, поскольку количество ГЭ ДНК B.pertussis в 5 мкл исследуемого образца у большинства животных в течение времени наблюдения не регистрировалось ниже, чем 102-103 молекул, при этом количество авирулентных мутантов B.pertussis было в среднем 102, что было значительно выше предельной чувствительности метода.

Нами показано, что бактерии возбудителя коклюша персистировали в легких мышей до 63-ого дня. Степень гетерогенности популяции бактерий B.pertussis возрастала за счет увеличения доли авирулентных инсерционных мутантов, количество которых к 49-63 дню после заражения достигало 50% от общего числа бактерий в популяции.

Таким образом, экспериментальный инфекционный процесс у мышей показал, что в результате персистенции возбудителя коклюша в макроорганизме происходит изменение фазового состава бактерий B.pertussis, накопление инсерционных авирулентных мутантов, формирование бактерионосительства, что согласуется с данными, полученными при изучении разработанным методом ПЦР-РВ клинических образцов от больных типичными и атипичными формами коклюша.


  1. Впервые разработана тест-система ПЦР-РВ, позволяющая выявлять в клинических образцах бактерии возбудителя коклюша, содержащие интеграции IS481 и IS1002 в опероне вирулентности bvgAS, и изучать фазовый состав популяции бактерий Bordetella pertussis.
  2. С помощью разработанной тест-системы ПЦР-РВ возбудитель коклюша выявлен у больных с клиническим диагнозом «ОРВИ» и смешанными респираторными инфекциями в 55,6% случаев, с симптомом «длительный кашель» – в 31% случаев.
  3. В 75% случаев бактерионосительство B.pertussis выявлено у «практически здоровых» детей и взрослых, контактировавших с больными.
  4. Клиническая картина коклюша коррелирует с фазовым составом популяции возбудителя: у больных типичными формами заболевания популяция бактерий B.pertussis практически не содержит авирулентных инсерционных Bvg- мутантов, у больных атипичными формами количество авирулентных мутантов составляет в среднем 0,2%, у практически здоровых бактерионосителей достигает 90%.
  5. Выявлено накопление авирулентных мутантов B.pertussis, содержащих интеграции IS481 и IS1002 в опероне вирулентности bvgAS, в процессе экспериментальной коклюшной инфекции у мышей.
  6. Разработанная тест-система ПЦР-РВ позволяет проводить лабораторную диагностику типичных и атипичных форм коклюша, бактерионосительства и изучать изменения фазового состава популяции возбудителя коклюша.

Список работ, опубликованных по теме диссертации:

  1. А.Ю. Медкова, Ю.С. Аляпкина, Л.Н. Синяшина, И.П. Амелина, Я.И. Алексеев, А.Г. Боковой, Г.И. Каратаев. Выявление инсерционных мутантов авирулентных bvg--мутантов Bordetella pertussis у больных коклюшем, острой респираторной вирусной инфекцией и практически здоровых людей. // Молекулярная генетика, микробиология и вирусология. 2010. №4. с. 9-13.
  2. А.Ю. Медкова, Ю.С. Аляпкина, Л.Н. Синяшина, И.П. Амелина, Я.И. Алексеев, Г.И. Каратаев, А.Г. Боковой. Распространенность стертых форм коклюша и анализ фазовых состояний бактерий Bordetella pertussis. // Детские инфекции. 2010. №4. с. 19-22.
  3. Ludmila N. Sinyashina, Alisa Yu. Medkova, Evgeniy G. Semin, Alexander V. Chestkov, Yuriy D. Tsygankov, and Gennadiy I. Karataev. IS481-Induced Variability of Bordetella pertussis. // In “National Institute of Allergy and Infectious Diseases, NIH: Frontiers in Research” Ed. Vassil St. Georgiev, Humana Press, Totowa, NJ.-2008.-p.227-231.
  4. А.Ю. Медкова, Г.И. Каратаев. Разработка тест-системы ПЦР для диагностики стертых и атипичных форм коклюша. // Материалы международной конференции студентов и молодых ученых «Ломоносов-2008». – Москва, 8-11 апреля 2008 г. – секция «Фундаментальная медицина», с. 16-17.
  5. А.Ю. Медкова, Г.И. Каратаев, Л.Н. Синяшина, А.Г. Боковой. Диагностическое значение фазовых состояний бактерий Bordetella pertussis.// Материалы научно-практической конференции «Актуальные проблемы педиатрии». – Калуга, 10-11 ноября 2009 г.
  6. А.Ю. Медкова, Г.И. Каратаев, Л.Н. Синяшина, А.Г. Боковой. Распространенность стертых форм коклюша и анализ фазовых состояний бактерий Bordetella pertussis.// Материалы IV Международной Школы молодых ученых по молекулярной генетике «Геномика и биология клетки». – Звенигород, 29 ноября – 3 декабря 2010 г.
  7. Д.Т. Кубрава, А.Ю. Медкова, З.В. Шевцова, А.З. Матуа, Л.Н. Синяшина, И.Г. Конджария, Г.И. Каратаев. Иммунный ответ у обезьян вида Macaca mulatta при интраназальном введении искусственно аттенуированных бактерий Bordetella pertussis, перспективных для совершенствования противококлюшных вакцин. // Материалы XIV Всероссийского научного форума «Дни иммунологии в Санкт-Петербурге». – Санкт-Петербург, 23-26 мая 2011 г.
  8. А.Ю. Медкова, Л.Н. Синяшина, А.Г. Боковой, Г.И. Каратаев. Персистенция бактерий Bordetella pertussis и изменение структуры популяции возбудителя коклюша, регистрируемые методом полимеразной цепной реакции в режиме реального времени (ПЦР-РВ). // Материалы международной научной конференции «Генетика и биотехнология XXI века: проблемы, достижения, перспективы». – Минск, 8-11 октября 2012 г.

Заявка на патент: Г.И. Каратаев, Л.Н. Синяшина, А.Ю. Медкова «Способ диагностики коклюша и определения авирулентных мутантов возбудителя и диагностический набор» №2011120790 от 24.05.2011г.

Список сокращений

АКДС – адсорбированная коклюшно-дифтерийно-столбнячная вакцина

ГЭ – геном-эквивалент

ИФА – иммуноферментный анализ

КОЕ – колониеобразующая единица

МКБ-10 – Международная классификация болезней десятого пересмотра

МОЕ – международные оптические единицы

ПЦР-РВ – полимеразная цепная реакция в режиме реального времени

РНГА – реакция непрямой гемагглютинации

РПГА – реакция прямой гемагглютинации

Вvg – bordetella virulence gene

dNTP – дезокситрифосфаты

IS – inserted sequence


Считаю своим приятным долгом выразить глубокую благодарность научным руководителям Г.И. Каратаеву и А.Г. Боковому за постоянное внимание, всестороннюю помощь, полученные знания и навыки.

За предоставленную возможность работать на приборе АНК-32 благодарю руководителя лаборатории хламидиозов ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России д.б.н. Зигангирову Н.А. Искренне признательна Ю.С. Аляпкиной и руководству ЗАО «Синтол» за оказанное содействие и большую помощь в разработке тест-системы ПЦР-РВ на начальных этапах работы. За многочисленные советы, помощь в проверке и отработке тест-системы, в организации проведения ПЦР-РВ, за прочтение рукописи диссертации, сделанные ценные замечания благодарю Ю.П. Пашко. Глубокую признательность выражаю заведующей отделением подопытных животных ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России Ветковой Л.Г. за решение организационных вопросов и неоценимую помощь при работе с животными. За предоставленные препараты ДНК, выделенной из назофарингеальных смывов от детей с клиническим диагнозом «Коклюш», благодарю д.м.н. Борисову О.Ю.

За всестороннюю помощь в работе, прочтение рукописи диссертации, ценные критические замечания и советы, поддержку выражаю глубокую благодарность Синяшиной Л.Н. За полученные знания, навыки, умения, поддержку благодарю Амелину И.П., Семина Е.Г., Алешкина Г.И., Смирнова Г.Б., Маркова А.П., Большакову Т.Н. Отдельную благодарность выражаю Корольковой Г.М. и Сильченко М.П.

Глубокую благодарность выражаю администрации ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России за предоставленную возможность заниматься научной работой и оказанное содействие в организации и проведении научных исследований.

Искреннюю благодарность и признательность выражаю ученому секретарю диссертационного совета ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России д.м.н., проф. Русаковой Е.В., а также Асратян А.А., Гащенко Т.А. и Кожевниковой Л.К. за помощь при подготовке диссертации к защите.



2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.