WWW.DISUS.RU

БЕСПЛАТНАЯ НАУЧНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

Инсерционная инактивация оперона вирулентности бактерий bordetella pertussis в диагностике типичных и атипичных форм коклюша

На правах рукописи

Медкова Алиса Юрьевна

Инсерционная инактивация оперона вирулентности бактерий

Bordetella pertussis в диагностике типичных и атипичных форм коклюша

03.02.03 – микробиология

14.01.09 – инфекционные болезни

Автореферат

диссертации на соискание ученой степени

кандидата медицинских наук

Москва

2013

Работа выполнена в Федеральном государственном бюджетном учреждении «Научно-исследовательский институт эпидемиологии и микробиологии имени почетного академика Н.Ф. Гамалеи» Министерства здравоохранения Российской Федерации

Научные руководители:

Доктор биологических наук Каратаев Геннадий Иванович

Доктор медицинских наук,

профессор Боковой Александр Григорьевич

Официальные оппоненты:

Доктор медицинских наук,

заведующий лабораторией

молекулярных основ патогенности

ФГБУ «НИИЭМ им. Н.Ф. Гамалеи»

МЗ РФ Белый Юрий Федорович

Доктор медицинских наук, профессор,

заведующая кафедрой инфекционных

болезней у детей №2 педиатрического

факультета ГБОУ ВПО РНИМУ

им. Н.И. Пирогова

МЗ РФ Шамшева Ольга Васильевна

Ведущая организация: Федеральное бюджетное учреждение науки «Московский научно-исследовательский институт эпидемиологии и микробиологии им. Г.Н. Габричевского» Роспотребнадзора

Защита диссертации состоится «22» февраля 2013 г. в 11 часов на заседании диссертационного совета Д 208.130.01 в НИИЭМ им. Н.Ф. Гамалеи Министерства здравоохранения РФ по адресу:

123098, г. Москва, ул. Гамалеи, д. 18.

С диссертацией можно ознакомиться в научной библиотеке НИИЭМ им. Н.Ф. Гамалеи Министерства здравоохранения РФ

Автореферат разослан «21» января 2013 г.

Ученый секретарь

диссертационного совета,

доктор медицинских наук, профессор Русакова Е.В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Коклюш – инфекционное респираторное заболевание человека, вызываемое грамотрицательными бактериями Bordetella pertussis, характеризующееся тяжелым течением и высокой летальностью у новорожденных и детей первого года жизни. Летальность при коклюше обусловлена развитием осложнений: апноэ, нарушения мозгового кровообращения, кровотечения из задне-глоточного пространства и бронхов, внутричерепные кровоизлияния, надрывы диафрагмы, коклюшная пневмония, эмфизема легких и др. Массовая противококлюшная вакцинация, проводимая в нашей стране с помощью АКДС-вакцины, начиная с 1950-х гг. прошлого столетия, значительно снизила летальность и заболеваемость коклюшем в типичной форме (Захарова М.С., 1969, Сигаева Л.А, 1986, Озерецковский Н.А., 2004). Несмотря на клиническую и лабораторную гиподиагностику коклюша, по данным ВОЗ, ежегодно в мире регистрируется до 50 миллионов случаев заболевания, умирает около 300 тысяч детей, преимущественно в возрасте до 1 года (WHO, 2003). В последние десятилетия во всем мире наблюдается рост заболеваемости коклюшем среди подростков и взрослых (Cherry J.D. et al., 2004, Отвагин С.А., 2005, Тимченко В.Н., 2009). Типичную клиническую картину коклюша наблюдают сегодня все реже, в основном, у не вакцинированных, наиболее восприимчивых к коклюшной инфекции младенцев до 5-6 месяцев и у детей старше 10 лет (Wood N. et al., 2008). Увеличивается число случаев атипичных форм коклюша: стертых, бессимптомных, абортивных, транзиторного бактерионосительства (Лобзин Ю.В., 2011). Эпидемиологические исследования подтвердили, что для восприимчивой группы детей источником инфекции являются подростки и взрослые, у которых коклюш, как правило, протекает в атипичных формах. Носителями возбудителя коклюша могут быть практически здоровые люди (Герасимова А.Г., 2004, Heininger U., 2004, Mattoo S., 2005).

Диагностика атипичных форм коклюша затруднена из-за отсутствия характерной клинической картины и адекватных лабораторных методов. Бактериологический метод на ранних стадиях коклюша выявляет возбудитель не более чем в 10% случаев даже при типичных формах заболевания (Борисова О.Ю., 2010), серологические методы (РНГА, РПГА, ИФА) подтверждают заболевание только на поздних стадиях, а нарастания титров специфических антител у бактерионосителей, как правило, не наблюдается (Ценева Г.Я., 2003). Раннее лабораторное подтверждение диагноза «Коклюш» особенно актуально в клинической практике для диагностики атипичных форм, определения тактики лечения и проведения противоэпидемических мероприятий в семейных очагах и организованных детских коллективах (Сипачева Н.Б., 2011).

Бактерии Bordetella pertussis – микроорганизмы, обладающие значительной изменчивостью, проявляющейся в появлении бактерий разной степени вирулентности. Это зависит от условий культивирования, длительности заболевания, лечения, ранее проведенной вакцинации (Friedrich M.J., 2011). Впервые на изменчивость B.pertussis in vivo было указано еще Трушиной-Тумановой Е.Ф. в 1949 г., выделившей непосредственно от 39 больных с различной клинической картиной коклюша 40 атипичных культур B.pertussis. Экспрессия генов вирулентности бактерий B.pertussis контролируется опероном вирулентности bvgAS. B.pertussis в I фазе (Вvg+) экспрессируют все факторы вирулентности. В результате мутаций, нарушающих структуру оперона bvgAS, происходит переход из I вирулентной фазы в IV авирулентную (Вvg–) фазу и изменение экспрессии факторов вирулентности (фазовые модуляции). Частичная потеря вирулентности наблюдается у B.pertussis во II и III фазах вирулентности, объединенных в понятие промежуточной фазы (Вvgi) (Tracy L. Nicholson et al., 2012).

Исследования по изучению регуляции генов вирулентности возбудителя коклюша, проводимые в ФГБУ НИИЭМ им. Н.Ф. Гамалеи МЗ РФ, показали, что перемещение инсерционных последовательностей (IS-элементов 481 и 1002) в оперон bvgAS является одним из механизмов, обеспечивающих переход бактерий B.pertussis из вирулентной I фазы в авирулентную IV фазу. Популяции бактерий B.pertussis in vitro были гетерогенны и содержали разное, зависящее от условий культивирования, количество вирулентных Вvg+ бактерий и авирулентных инсерционных Вvg– мутантов. Соотношение между числом вирулентных и авирулентных бактерий было названо фазовым составом популяции бактерий B.pertussis (Каратаев Г.И., 2008). Вероятно, in vivo с течением инфекционного процесса происходит накопление авирулентных инсерционных мутантов возбудителя коклюша и формирование бактерионосительства.

Разработка метода быстрой идентификации возбудителя коклюша и определения фазового состава популяции бактерий B.pertussis поможет улучшить диагностику атипичных форм коклюша. Установление корреляции между фазовым составом популяции бактерий B.pertussis и клинической картиной заболевания позволит определить тактику лечения и проведения противоэпидемических мероприятий.

Цель работы: регистрация инсерционных авирулентных Bvg– мутантов бактерий B.pertussis in vivo и выявление корреляции между клинической картиной заболевания у больных типичными и атипичными формами коклюша и фазовым составом популяции возбудителя.

Для достижения поставленной цели были решены следующие задачи:

  1. Разработка тест-системы ПЦР в режиме реального времени (ПЦР-РВ) для количественного определения ДНК бактерий B.pertussis в клинических образцах, содержащих инсерции IS481 и IS1002 в опероне вирулентности bvgAS.
  2. Выявление бактерий B.pertussis с помощью ПЦР-РВ в сравнении с бактериологическим методом в назофарингеальных мазках от больных типичными и атипичными формами коклюша и практически здоровых детей и взрослых, контактировавших и не контактировавших с больными.
  3. Количественное определение авирулентных бактерий B.pertussis, содержащих инсерциии IS481 и IS1002 в опероне bvgAS в ПЦР-РВ положительных клинических образцах.
  4. Установление корреляции между клинической картиной заболевания у больных типичными и атипичными формами коклюша и фазовым составом популяции бактерий B.pertussis.
  5. Изучение сроков персистенции и фазового состава популяции бактерий B.pertussis разработанным методом ПЦР-РВ при экспериментальном заражении мышей вирулентными бактериями B.pertussis.

Научная новизна. Впервые разработан неинвазивный количественный метод для выявления возбудителя коклюша и его инсерционных авирулентных (Bvg–) мутантов для изучения фазового состава популяции бактерий B.pertussis у больных типичными и атипичными формами заболевания.

Впервые показано, что популяции бактерий B.pertussis у больных различными формами коклюша гетерогенна, установлена корреляция между её фазовым составом и клинической картиной заболевания: абсолютное большинство бактерий B.pertussis у больных типичными формами коклюша содержит интактный оперон вирулентности (I фаза, Bvg+), тогда как у больных атипичными формами коклюша – в среднем 0,2% инсерционных авирулентных Вvg– мутантов, у бактерионосителей – от 10 до 90%.

Впервые показано, что ДНК возбудителя коклюша выявляется у 55,6% больных с диагнозом «ОРВИ» и смешанными респираторными инфекциями, у 31% больных – с симптомом «длительный кашель».

ДНК B.pertussis была выявлена у 75% «практически здоровых» детей и взрослых, контактировавших с больными.

Научно-практическая значимость работы. Разработанная тест-система ПЦР-РВ предназначена для дифференциальной диагностики респираторных инфекций, трудно поддающихся этиотропной терапии, в комплексе с общепринятыми методами диагностики коклюша (бактериологическому и серологическому).

С помощью созданной тест-системы ПЦР-РВ будет возможно проведение развернутых эпидемиологических обследований для изучения сроков персистенции бактерий и проведения адекватных санитарных мероприятий (карантина и т.д.).

Использование тест-системы ПЦР-РВ необходимо для оценки эффективности коклюшных вакцин, совершенствования и разработки новых профилактических препаратов, а также в фундаментальных научно-исследовательских работах, направленных на дальнейшее изучение механизмов образования персистирующих форм бактерий.

По результатам работы подготовлены Методические рекомендации «Способ выявления авирулентных бактерий Bordetella pertussis, сформированных в результате инсерций IS-элементов 481 и 1002 в оперон вирулентности bvgAS, у больных атипичными формами коклюша», утвержденные Советом по внедрению научных достижений в практику ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России 22 ноября 2012 г., протокол № 22.

Основные положения, выносимые на защиту:

  1. Разработана тест-система ПЦР-РВ, позволяющая в клинических образцах выявлять бактерии возбудителя коклюша и изучать фазовый состав популяции бактерий Bordetella pertussis у больных типичными и атипичными формами коклюша.
  2. С помощью разработанной тест-системы ПЦР-РВ показана широкая распространенность возбудителя коклюша среди больных с инфекционной респираторной патологией, а также возможность носительства бактерий B.pertussis практически здоровыми людьми.
  3. Установлена корреляция между клинической картиной коклюша у больных типичными и атипичными формами и фазовым составом популяции бактерий B.pertussis.
  4. Разработанный способ выявления авирулентных инсерционных мутантов B.pertussis позволяет изучать механизмы изменения популяции возбудителя коклюша в процессе развития инфекционного процесса.

Апробация работы. Результаты работы доложены на Международной научной конференции студентов, аспирантов и молодых ученых «Ломоносов-2008», 3-е место (Москва), на научно-практической конференции Научного Центра Здоровья Детей РАМН «Актуальные проблемы педиатрии» в рамках конкурса молодых ученых (Москва, 2009), на Международной школе по молекулярной генетике «Геномика и биология клетки» (Звенигород, 2010), на XIV Всероссийском научном форуме «Дни иммунологии в Санкт-Петербурге», в рамках конкурса молодых ученых, 1-е место (Санкт-Петербург, 2011), на международной научной конференции «Генетика и биотехнология XXI века: проблемы, достижения, перспективы» (Минск, 2012). Защищена дипломная работа на факультете фундаментальной медицины Московского Государственного Университета им. М.В. Ломоносова «Диагностическое значение фазовых состояний возбудителя коклюша (Bordetella pertussis), выявляемого в клинических образцах детей и взрослых с диагнозом «ОРЗ» (Москва, 2009).

Апробация работы состоялась 8 июня 2012 г. на совместной научной конференции отдела генетики и молекулярной биологии бактерий и отдела медицинской микробиологии ФГБУ «НИИЭМ им. Н.Ф. Гамалеи» Минздрава России.

Публикации. По теме диссертации опубликовано 8 научных работ, в том числе две статьи в журналах, рекомендованных ВАК, и одна статья – в зарубежном издательстве. По результатам работы подана заявка на получение патента (2011 г).

Объем и структура работы. Диссертация изложена на 105 страницах машинописного текста и включает введение, обзор литературы, описание материалов и методов, собственные исследования, обсуждение результатов исследований, выводы и список использованной литературы, содержащий ссылки на 34 отечественных и 151 иностранный источник. Работа иллюстрирована 15 таблицами и 8 рисунками.

МАТЕРИАЛЫ И МЕТОДЫ

В ходе работы обследовано 157 детей и взрослых, госпитализированных в детское инфекционное отделение ФГБУ ЦКБ с поликлиникой УДП РФ, в инфекционную клиническую больницу №1 г. Москвы, а также направленных на консультацию для уточнения диагноза в ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России: 15 больных с диагнозом «Коклюш, типичная форма», 18 больных с диагнозом «ОРВИ», смешанными вирусно-бактериальными респираторными инфекциями, 26 пациентов с симптомом «длительный кашель», а также 98 практически здоровых детей и взрослых, контактировавших и не контактировавших с больными (таблица. 3). Для лабораторного подтверждения клинического диагноза в стационаре применялись бактериологический, серологический и молекулярно-биологический методы. Диагнозы верифицировали на основании клинико-эпидемиологических и лабораторных данных в соответствии с общепринятой классификацией (МКБ-10).

Для бактериологического посева и ПРЦ-РВ исследования назофарингеальные мазки брали от больных на 3-4-й день госпитализации, до начала специфического антибактериального лечения в соответствии с «Требованиями к взятию и транспортировке материала для лабораторной диагностики коклюша» Комитета Здравоохранения г. Москвы от 25 ноября 2002 года № 539/№ 230 с помощью ватного тампона типа Dacron. Одновременно обследовали матерей по уходу за ребенком и ближайших родственников, контактировавших с больными.

Микробиологическую идентификацию возбудителя коклюша проводили в соответствии с «Инструкцией по отбору, проверке и хранению штаммов B.pertussis для изготовления коклюшной вакцины и коклюшного компонента ассоциированных вакцин» (1987).

Штаммы бактерий, использованные в работе. В работе использованы бактерии из коллекции музея ФГБУ «НИИЭМ им. Н.Ф. Гамалеи» Минздрава России. Бактерии Bordetella ssp. культивировали на плотной питательной среде КУА с добавлением 15% дефибринированной крови барана в течение 3-5 суток, E.coli – на L-агаре, другие бактерии – на соответствующих специфических питательных средах.

Лабораторные животные. Беспородные белые мыши обоего пола, 3-4-х недельного возраста, весом 10-12 г.

Мышей экспериментально заражали живыми вирулентными бактериями B.pertussis 134 I фазы (Bvg+) внутривенно и интраназально по 80 мышей в каждой группе. В хвостовую вену мыши вводили 30 мкл суспензии, содержащей 3х109 МОЕ/мл бактерий B.pertussis. При интраназальном заражении в каждую ноздрю вводили 25 мкл суспензии, содержащей 3х107 МОЕ/мл бактерий B.pertussis. Мышей усыпляли Нембуталом (Синяшин Н.И., 1986). Контрольным мышам (по 24 мыши в каждой группе) вводили стерильный 0,85% раствор хлорида натрия, 25 и 30 мкл интраназально и внутривенно соответственно.

Микробиологическое исследование и выделение ДНК от экспериментально зараженных мышей. У 10 мышей из каждой группы извлекали легкие через 2 и 24 часа, 7-й, 14-й, 28-й, 42-й, 49-й и 63-й дни после заражения. Легкие гомогенизировали в 1 мл 0,85% раствора хлорида натрия (рН 7,2-7,4), инкубировали 15 мин при температуре 350С и центрифугировали при 3000 об/мин 7 мин. Надосадочную жидкость разводили в 100, 10 000 и 1000 000 раз, затем по 0,1 мл из каждого разведения высевали на три чашки Петри с селективной средой КУА, по 500 мкл супернатанта без разведения использовали для выделения ДНК. В каждой точке наблюдения подсчитывали число выросших колоний на всех чашках Петри. Среднее количество КОЕ в легких каждой мыши (М, КОЕ/мл) рассчитывали по формуле:

Для выделения ДНК B.pertussis из клинических образцов и супернатантов гомогенатов легких мышей в соответствии с инструкцией к набору Wizard Genomic DNA Purification System (Promega, США) использовали магнитный сорбент.

ПЦР-РВ проводили на приборе АНК-32ТМ (Россия) с использованием праймеров и зондов, синтезированных ЗАО «Синтол» и «Евроген». Nested-ПЦР – на приборе «Терцик» (Россия).

Секвенирование фрагментов ДНК проводили на приборе 373А Automatic Sequencer (Applied Biosystems, USA) с рекомендуемым набором реактивов.

Статистическая обработка результатов выполнена с помощью программы Microsoft Excel 2007 и статистических методов, принятых в биологии и медицине (Гланц С., 1999).

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ

1. Разработка тест-системы ПЦР-РВ для выявления ДНК возбудителя коклюша и анализа фазового состава популяции бактерий Bordetella pertussis

На первом этапе работы была создана тест-система ПЦР-РВ, позволяющая выявлять ДНК возбудителя коклюша, регистрировать наличие инсерционных последовательностей IS481 и IS1002 в сctagg сайте оперона вирулентности bvgAS B.pertussis и изучать фазовый состав популяции возбудителя. Для анализа фазового состава популяции бактерий B.pertussis рассчитывали значения n481 и n1002 – отношение числа инсерций IS481 и IS1002 (N481 и N1002) в оперон bvgAS к общему количеству ДНК B.pertussis в 5 мкл анализируемого образца (QBp).

Выбор праймеров и зондов. В основу выбора праймеров и зондов для определения количества геном-эквивалентов (ГЭ) ДНК B.pertussis и количества геномов B.pertussis, содержащих интеграции IS481 и IS1002 в cctagg сайте оперона bvgAS, положена схема, представленная на рисунке 1.

Тест-система ПЦР-РВ включает две независимые реакции, протекающие в одной пробирке. Первая реакция позволяет определить количество IS481 (N481) в исследуемом образце ДНК, а вторая – IS1002 (N1002). В первой и второй реакциях использовали праймеры Bp481-42–Bp111, Bp1002-33–Bp111 и зонды R6G-481, ROX-1002 соответственно (таблица 1).

Таблица 1. Последовательности праймеров и зондов, использованные для детекции IS481 и IS1002 и их интеграций в cctagg сайт оперона bvgAS B.pertussis и для конструирования плазмид pIS481 и pIS1002

Праймер/ зонд Последовательность нуклеотидов Примечание*
Bp481-42 GAACCGGATTTGAGAAACTGGAAA IS481
Bp111 ttcaggcacacaaacttgatgggcg IS481, IS1002
Bp1002-33 AGGCCGGACCTGGGATG IS1002
SF GTCGCTGGTGGAACTGATAG bvgАS
AR acgaggtgcgaggtggtcag bvgAS
Bp2 ttcaggcacacaaacttgatgggcg IS481
Rох-1002 (ROX)ACCFCGCCATCGCAACTCAGGGCA(RTQ2) зонд IS1002
R6G-481 (R6G)TCGCCGACCCCCCAGTTCACTCAAG(BHQ2) зонд IS481

* - положение праймеров и зондов изображено на рисунке 1

Условия амплификации приведены в таблице 2. Объем реакционной смеси 25 мкл (ЗАО «Синтол», Россия) содержал 2,5 ед. Hot-Rescue Taq-полимеразы, 2,5 мкл 10-кратного KCl-ПЦР-буфера, по 250 мкМ dNTP, праймеры по 10 pmol и зонды по 5 pmol на одну реакцию, 5 мкл исследуемого образца ДНК B.pertussis.

Таблица 2. Температурно-временной профиль ПЦР-РВ

Температура Время, секунды Количество циклов
95°С 300 1
65°С 50 50
95°С 20 50

Конструирование плазмид pIS481 и pIS1002 для определения количественных характеристик популяции бактерий B.pertussis в реакции ПЦР-РВ. Для построения калибровочных кривых для определения количества ГЭ ДНК B.pertussis и инсерций IS481 и IS1002 в сctagg сайт оперона bvgAS были сконструированы плазмиды рIS1002 и pIS481, включающие фрагменты последовательностей хромосомы B.pertussis, сформированные в результате искомых инсерций.

Рис. 1. Структура фрагмента хромосомы B.pertussis, содержащего инсерцию IS481 или IS1002 в сctagg сайт оперона bvgAS

Для конструирования плазмиды рIS1002 использован фрагмент амплификации хромосомы B.pertussis 54.1, Вvg– мутант, содержащий инсерцию IS1002 в cctagg сайте оперона bvgAS (Sinyashina L.N. et al., 2008), с праймерами SF–AR, для конструирования плазмиды рIS481 – продукт амплификации ДНК B.pertussis Tohama I фазы с праймерами SF–Bp2 (таблица 1). Клонирование проводили с использованием системы pGemT (Promega, США) согласно руководству к её применению. Структуру рекомбинантных плазмид определяли с помощью ПЦР, рестрикции и секвенирования клонированного фрагмента.

По результатам ПЦР-РВ серии разведений pIS481 и рIS1002 с праймерами Bp481-42–Bp111, Bp1002-33–Bp111 и зондами R6G-481, ROX-1002 были построены калибровочные кривые, позволяющие выявлять количество копий IS481 и IS1002 в исследуемом образце (Q481 и Q1002). С помощью построения аналогичных калибровочных кривых ПЦР-РВ с праймерами SF-Bp111 и зондами R6G-481и ROX-1002 определяли количество ДНК B.pertussis, содержащей инсерции IS1002 и IS481 в опероне bvgAS (N481 и N1002).

Количество молекул ДНК B.pertussis, содержащих инсерции IS1002 и IS481 в cctagg сайте оперона bvgAS, было определено как соотношение n481, 1002 = N481, 1002/QBp, где количество ГЭ B.pertussis – QBp рассчитано как среднее значение величин QBp481 = Q481/ 238 и QBp1002 = Q1002/ 6. Числа 238 и 6 соответствуют количеству копий IS481 и IS1002 в секвенированной хромосоме B.pertussis Tohama I фазы (Julian Parkhill et al., 2003).

Чувствительность и специфичность разработанной тест-системы ПЦР-РВ. С помощью ПЦР-РВ серии разведений ДНК B.pertussis 54.1, Tohama I и рIS481 и рIS1002 было установлено, что чувствительность тест-системы составляет одну копию ГЭ ДНК B.pertussis и порядка 10-20 копий последовательностей IS481 и IS1002 в ссtagg сайте оперона. Высокая чувствительность при определении количества ГЭ ДНК B.pertussis объясняется копийностью повторяющихся последовательностей IS481и IS1002 (238 и 6, соответственно), используемой в качестве мишени при постановке ПЦР.

Проверку специфичности выбранных праймеров и зондов проводили в поисковой системе BLAST, а также в ПЦР-РВ на образцах ДНК различных микроорганизмов, в том числе вызывающих респираторные инфекции: B.parapertussis, B.bronchiseptica, Staph.aureus, Staph.epidermidis, Neisseria meningitidis, M.tuberculosis, E.сoli K12, L.pneumophilia, K.pneumoniae, C.diphteriae, S.typhimurium, Sh.sonnei, Sh.flexneri, Y.pseudotuberculosis, Chl.pneumoniae, Myc.pneumoniae, Str.pneumoniae. Результаты анализа ДНК всех перечисленных микроорганизмов с помощью разработанной нами тест-системы ПЦР-РВ не выявили достоверных сигналов амплификации.

Таким образом, нами разработана специфичная и высокочувствительная тест-система ПЦР-РВ, позволяющая выявлять в клинических образцах единичные копии ДНК B.pertussis и 10 ГЭ ДНК B.pertussis, содержащих инсерции IS481 и IS1002 в cctagg сайт оперона bvgAS.

2. Выявление возбудителя коклюша у больных типичными и атипичными формами заболевания и анализ фазового состава популяции бактерий B.pertussis

Для проведения исследования были собраны назофарингеальные мазки от больных с диагнозом: «Коклюш, типичная форма» – 15 образцов, с диагнозом «ОРВИ» и со смешанными вирусно-бактериальными респираторными инфекциями – 18, с симптомом «длительный кашель» – 26, «практически здоровых» детей и взрослых, контактировавших с больными, – 16 и от «практически здоровых» взрослых и детей, не контактировавших с больными, – 82. Образцы были исследованы с помощью бактериологического метода и ПЦР-РВ. Результаты анализа представлены на рисунке 2 и в таблице 3.

Таблица 3. Сравнительные результаты бактериологического метода и ПЦР-РВ по выявлению возбудителя коклюша в клинических образцах

Клинический диагноз Количество образцов Идентификация B.pertussis, бак. метод Идентификация ДНК B.pertussis, ПЦР-РВ
Коклюш 15 6 (40%) 14 (93,3%)
ОРВИ, смешанные респираторные инфекции 18 2 (11,1%) 10 (55,6%)
Длительный кашель 26 2 (7,7%) 8 (31%)
Практически здоровые взрослые и дети, контактировавшие с больными 16 не обнаружено 12 (75%)
Практически здоровые дети и взрослые, не контактировавшие с больными 82 не обнаружено 6 (7,3%)
Общее количество образцов 157 10 50

Из представленных данных видно, что у больных типичными формами коклюша ДНК возбудителя методом ПЦР-РВ выявлена в 93,3% случаев, бактериологическим методом – в 40%. ДНК B.pertussis выявлена у 55,6% больных с диагнозом «ОРВИ» и смешанными вирусно-бактериальными респираторными инфекциями, в то же время бактериологическим методом возбудитель коклюша был обнаружен в 11%. У больных с симптомом «длительный кашель» в 31% случаев – методом ПЦР-РВ, в 7,7% – бактериологическим методом. У практически здоровых детей и взрослых, контактировавших с больными, методом ПЦР-РВ возбудитель коклюша был обнаружен в 75% случаев, в группе не контактировавших с больными – 7,3%. Бактериологическим методом B.pertussis в этой группе не выявлена.

Сравнение результатов бактериологического посева и ПЦР-РВ показало высокую эффективность метода ПЦР-РВ и разработанной нами тест-системы.

Рис. 2. Выявление возбудителя коклюша бактериологическим методом и ПЦР-РВ

По результатам количественного ПЦР-РВ анализа ДНК возбудителя коклюша пациенты были разделены на три группы для изучения фазового состава популяций бактерий B.pertussis.

В первую группу включили 14 пациентов с максимальным количеством ДНК B.pertussis – 106-107 ГЭ в 5 мкл образца. Относительное количество интеграций IS481 и IS1002 составляло в среднем 10-5. Следовательно, абсолютное большинство бактерий в популяции находились в I фазе, вирулентном состоянии (Bvg+). Независимо от возраста и сопутствующих инфекций у больных этой группы наблюдали типичную клиническую картину коклюша (таблица 4).

Во вторую группу отнесли 18 пациентов, в клинических образцах которых зарегистрировано 103 –104 ГЭ ДНК B.pertussis. Частота интеграций IS481 и IS1002 у этих пациентов составила в среднем 10-3 (таблица 4). В этой группе оказались пациенты с диагнозом «ОРВИ», смешанными вирусно-бактериальными респираторными инфекциями, с симптомом «длительный кашель».

Третья группа – 20 пациентов с количеством ДНК B.pertussis в образцах от нескольких десятков до нескольких сотен ГЭ – практически здоровые дети и взрослые, контактировавшие и не контактировавшие с больными. Частота регистрации инсерционных авируленных Bvg– мутантов в этой группе достигала 90% (таблица 4).

Таблица 4. Анализ фазового состава популяций бактерий B.pertussis

Клинический диагноз, число обследованных больных Количество ДНК B.pertussis Относительное количество интеграций (n)
n481 n1002
Коклюш, типичные формы, n=14 (5,6±1,6)*106 (4,8±4,4)*10-5 (7,1±6,2)*10-6
ОРВИ, смешанные респираторные инфекции, длительный кашель, n=18 (9,7±2,7)*103 (1,6±1,5)*10-3 (1,4±1,3)*10-4
Практически здоровые, контактировавшие и не контактировавшие с больными, n=20 (1,3±0,9)*102 0,5±0,4 0,4±0,4

Для подтверждения того, что регистрируемые нами продукты ПЦР действительно представляют собой структуры, сформированные в результате интеграции IS-элементов в cсtagg сайт оперона bvgAS, проведено секвенирование продуктов амплификации 3-х образцов ДНК, в которых в 5 мкл было выявлено 10-30 инсерций IS-элементов.

Продукты амплификации для секвенирования получены в результате постановки nested-ПЦР: первая ПЦР с праймерами SF-Bp2, вторая – с праймерами SF-Bp111 (рис. 1). Определённая последовательность полностью совпадала с ожидаемой, сформированной в результате интеграции IS481 в cctagg сайт оперона bvgAS. Не было обнаружено каких-либо изменений ни в последовательности IS-элемента, ни в прилегающей последовательности оперона bvgAS.

Таким образом, с помощью разработанной тест-системы ПЦР-РВ впервые получены лабораторно подтвержденные данные о значительной распространенности атипичных форм коклюша у больных ОРВИ и смешанными респираторными инфекциями, носительстве возбудителя коклюша практически здоровыми людьми.

Анализ фазового состава показал гетерогенность популяций бактерий B.pertussis у обследованных пациентов. У больных типичными формами коклюша бактерии B.pertussis находились в I фазе и содержали интактный оперон вирулентности (Bvg+). Популяции бактерий B.pertussis у больных атипичными формами коклюша содержали в среднем 0,2% инсерционных авирулентных Вvg– мутантов, у практически здоровых бактерионосителей их количество составляло от 10 до 90%.

Организационные сложности, возникающие при длительном наблюдении и повторном обследовании больных, не позволяют изучать фазовый состав популяции возбудителя коклюша, накопление авирулентных инсерционных Bvg– мутантов B.pertussis с течением инфекционного процесса и формирование бактерионосительства. В связи с этим нами было предпринято изучение сроков персистенции и фазового состава популяции бактерий B.pertussis с помощью разработанной тест-системы ПЦР-РВ при экспериментальном заражении мышей.

3. Изучение сроков персистенции и фазового состава популяции бактерий B.pertussis при экспериментальном заражении мышей

Лабораторные мыши являются общепринятой моделью для изучения степени вирулентности бактерий B.pertussis, токсичности и безвредности коклюшных вакцин для переноса результатов экспериментов in vivo непосредственно на людей.

Для изучения сроков персистенции возбудителя коклюша и накопления инсерционных авирулентных мутантов B.pertussis в процессе развития инфекционного процесса экспериментально инфицировали вирулентными бактериями B.pertussis 134 беспородных белых мышей.

Для идентификации возбудителя коклюша и анализа фазового состава бактерий B.pertussis в гомогенатах легких мышей использовали те же методы, что и при изучении клинических образцов.

Определение сроков персистенции бактерий B.pertussis при экспериментальном заражении мышей.

Внутривенно и интраназально заражали по 80 мышей. В каждой группе было по 24 контрольные мыши, которым вводился стерильный 0,85% раствор хлорида натрия.

Идентификацию возбудителя коклюша в легких зараженных (10 мышей из каждой группы) и контрольных (3 мыши из каждой группы) животных проводили с помощью бактериологического метода путем посева супернатантов гомогенатов легких на среду КУА через 2 и 24 часа, 7-й, 14-й, 28-й, 42-й, 49-й и 63-й дни после заражения.

Независимо от способа инфицирования при посеве на селективную среду КУА супернатантов гомогенатов легких мышей максимальное число КОЕ наблюдали до 14-ого дня после заражения. На 28-й день регистрировались единичные колонии (рис. 3).

 Обнаружение B.pertussis 134 бактериологическим методом в легких мышей-2

Рис. 3. Обнаружение B.pertussis 134 бактериологическим методом в легких мышей после внутривенного и интраназального заражения

Результаты средних значений М – количества КОЕ в 1 мл гомогенатов легких 10 мышей в каждой группе, рассчитанных по формуле, рекомендованной ВОЗ для подсчета КОЕ B.pertussis в легких зараженных мышей, – представлены в таблице 5.

Таблица 5. Сравнительное выявление бактерий B.pertussis в легких мышей бактериологическим методом и ПЦР-РВ при экспериментальном заражении

Срок наблю-дения Бактериологический посев, КОЕ/мл, n=10 ПЦР-РВ, количество ГЭ ДНК B.pertussis, n=10
в/в* и/н** в/в и/н
2 часа роста нет (4±0,4)*103 н/о (3,7±1,3)*102
24 часа роста нет (2,6±0,4)*103 (1,1±0,25) *102 (8,5±1,2)*102
7 день (2,8±0,5)*103 (3±0,9)*103 (3,7±5,7)*103 (1,5±0,8)*108
14 день (2,5±0,2)*104 (2,6±0,2)*104 (6,5±4,4)*105 (1,4±0,8)*106
28 день (8,2±1,02)*103 (4,9±1,54)*103 (4,9±7,7)*104 (5,2±2,7)*103
42 день роста нет роста нет (8,7±5,2)*103 (9,7±4,2)*103
49 день роста нет роста нет (1,9±1,2)*103 (4,2±2,3)*103
63 день роста нет роста нет (5,3±1,9)*102 (3,4±2,1)*102

* внутривенное заражение

** интраназальное заражение

роста нет – не обнаружен рост B.pertussis как при посеве разведений супернатантов гомогенатов легких, так и без разведения

н/о – не обнаружено

В легких контрольных мышей бактерии B.pertussis 134 не были обнаружены ни бактериологическим методом, ни ПЦР-РВ.

Результаты определения количества ГЭ ДНК бактерий B.pertussis в легких мышей на разных сроках после внутривенного и интраназального заражения B.pertussis 134 представлены на рисунке 4. Точки на графике соответствуют количеству геном-эквивалентов в 5 мкл образца ДНК B.pertussis, определенному как среднее значение этого показателя у десяти мышей (таблица 5).

 Динамика изменения содержания ГЭ ДНК B.pertussis в легких мышей после-3

Рис. 4. Динамика изменения содержания ГЭ ДНК B.pertussis в легких мышей после экспериментального заражения

Максимальное количество ДНК B.pertussis, независимо от способа заражения, было зарегистрировано в лёгких мышей на 7 и 14 дни, а затем снижалось с течением инфекционного процесса, что соответствовало срокам развития заболевания у людей в типичной форме (рис. 4). ДНК B.pertussis выявляли с помощью разработанной тест-системы ПЦР-РВ в легких мышей до 63 дня после заражения (срок наблюдения). Таким образом, с помощью разработанной тест-системы ПЦР-РВ бактерии B.pertussis выявляли в легких мышей до 63-го дня наблюдения, и, возможно, эти сроки переживания возбудителя коклюша у животных соответствуют времени персистенции бактерий в организме человека, более длительного, чем установлено карантином – 21 день.

Изучение фазового состава популяции бактерий B.pertussis в легких мышей при экспериментальном инфекционном процессе

В каждой точке наблюдения определяли фазовый состав популяции бактерий B.pertussis. Для этого в ДНК B.pertussis, выделенной из легких инфицированных мышей, с помощью разработанной нами тест-системы ПЦР-РВ определяли количество интеграций IS481 и IS1002 в опероне bvgAS. Результаты эксперимента представлены на рис 5. По оси ординат отложены значения десятичного логарифма n (lg n), где n=N481/QBp.

Рис. 5. Динамика накопления авирулентных (Bvg-) инсерционных мутантов B.pertussis 134 в легких мышей при экспериментальном инфекционном процессе

Через 2 и 24 часа после интраназального и внутривенного заражения вирулентным штаммом B.pertussis только 10-5–10-6 бактерий содержали интеграции IS481 или IS1002 в опероне вирулентности bvgAS. При обоих способах заражения относительное число авирулентных мутантов B.pertussis в анализируемой популяции нарастает, начиная с 7-ого дня, и достигает к 63-му дню 50% от общего объёма бактериальной популяции (рис. 5). Достоверность определения параметров популяции не вызывала сомнения, поскольку количество ГЭ ДНК B.pertussis в 5 мкл исследуемого образца у большинства животных в течение времени наблюдения не регистрировалось ниже, чем 102-103 молекул, при этом количество авирулентных мутантов B.pertussis было в среднем 102, что было значительно выше предельной чувствительности метода.

Нами показано, что бактерии возбудителя коклюша персистировали в легких мышей до 63-ого дня. Степень гетерогенности популяции бактерий B.pertussis возрастала за счет увеличения доли авирулентных инсерционных мутантов, количество которых к 49-63 дню после заражения достигало 50% от общего числа бактерий в популяции.

Таким образом, экспериментальный инфекционный процесс у мышей показал, что в результате персистенции возбудителя коклюша в макроорганизме происходит изменение фазового состава бактерий B.pertussis, накопление инсерционных авирулентных мутантов, формирование бактерионосительства, что согласуется с данными, полученными при изучении разработанным методом ПЦР-РВ клинических образцов от больных типичными и атипичными формами коклюша.

ВЫВОДЫ

  1. Впервые разработана тест-система ПЦР-РВ, позволяющая выявлять в клинических образцах бактерии возбудителя коклюша, содержащие интеграции IS481 и IS1002 в опероне вирулентности bvgAS, и изучать фазовый состав популяции бактерий Bordetella pertussis.
  2. С помощью разработанной тест-системы ПЦР-РВ возбудитель коклюша выявлен у больных с клиническим диагнозом «ОРВИ» и смешанными респираторными инфекциями в 55,6% случаев, с симптомом «длительный кашель» – в 31% случаев.
  3. В 75% случаев бактерионосительство B.pertussis выявлено у «практически здоровых» детей и взрослых, контактировавших с больными.
  4. Клиническая картина коклюша коррелирует с фазовым составом популяции возбудителя: у больных типичными формами заболевания популяция бактерий B.pertussis практически не содержит авирулентных инсерционных Bvg- мутантов, у больных атипичными формами количество авирулентных мутантов составляет в среднем 0,2%, у практически здоровых бактерионосителей достигает 90%.
  5. Выявлено накопление авирулентных мутантов B.pertussis, содержащих интеграции IS481 и IS1002 в опероне вирулентности bvgAS, в процессе экспериментальной коклюшной инфекции у мышей.
  6. Разработанная тест-система ПЦР-РВ позволяет проводить лабораторную диагностику типичных и атипичных форм коклюша, бактерионосительства и изучать изменения фазового состава популяции возбудителя коклюша.

Список работ, опубликованных по теме диссертации:

  1. А.Ю. Медкова, Ю.С. Аляпкина, Л.Н. Синяшина, И.П. Амелина, Я.И. Алексеев, А.Г. Боковой, Г.И. Каратаев. Выявление инсерционных мутантов авирулентных bvg--мутантов Bordetella pertussis у больных коклюшем, острой респираторной вирусной инфекцией и практически здоровых людей. // Молекулярная генетика, микробиология и вирусология. 2010. №4. с. 9-13.
  2. А.Ю. Медкова, Ю.С. Аляпкина, Л.Н. Синяшина, И.П. Амелина, Я.И. Алексеев, Г.И. Каратаев, А.Г. Боковой. Распространенность стертых форм коклюша и анализ фазовых состояний бактерий Bordetella pertussis. // Детские инфекции. 2010. №4. с. 19-22.
  3. Ludmila N. Sinyashina, Alisa Yu. Medkova, Evgeniy G. Semin, Alexander V. Chestkov, Yuriy D. Tsygankov, and Gennadiy I. Karataev. IS481-Induced Variability of Bordetella pertussis. // In “National Institute of Allergy and Infectious Diseases, NIH: Frontiers in Research” Ed. Vassil St. Georgiev, Humana Press, Totowa, NJ.-2008.-p.227-231.
  4. А.Ю. Медкова, Г.И. Каратаев. Разработка тест-системы ПЦР для диагностики стертых и атипичных форм коклюша. // Материалы международной конференции студентов и молодых ученых «Ломоносов-2008». – Москва, 8-11 апреля 2008 г. – секция «Фундаментальная медицина», с. 16-17.
  5. А.Ю. Медкова, Г.И. Каратаев, Л.Н. Синяшина, А.Г. Боковой. Диагностическое значение фазовых состояний бактерий Bordetella pertussis.// Материалы научно-практической конференции «Актуальные проблемы педиатрии». – Калуга, 10-11 ноября 2009 г.
  6. А.Ю. Медкова, Г.И. Каратаев, Л.Н. Синяшина, А.Г. Боковой. Распространенность стертых форм коклюша и анализ фазовых состояний бактерий Bordetella pertussis.// Материалы IV Международной Школы молодых ученых по молекулярной генетике «Геномика и биология клетки». – Звенигород, 29 ноября – 3 декабря 2010 г.
  7. Д.Т. Кубрава, А.Ю. Медкова, З.В. Шевцова, А.З. Матуа, Л.Н. Синяшина, И.Г. Конджария, Г.И. Каратаев. Иммунный ответ у обезьян вида Macaca mulatta при интраназальном введении искусственно аттенуированных бактерий Bordetella pertussis, перспективных для совершенствования противококлюшных вакцин. // Материалы XIV Всероссийского научного форума «Дни иммунологии в Санкт-Петербурге». – Санкт-Петербург, 23-26 мая 2011 г.
  8. А.Ю. Медкова, Л.Н. Синяшина, А.Г. Боковой, Г.И. Каратаев. Персистенция бактерий Bordetella pertussis и изменение структуры популяции возбудителя коклюша, регистрируемые методом полимеразной цепной реакции в режиме реального времени (ПЦР-РВ). // Материалы международной научной конференции «Генетика и биотехнология XXI века: проблемы, достижения, перспективы». – Минск, 8-11 октября 2012 г.

Заявка на патент: Г.И. Каратаев, Л.Н. Синяшина, А.Ю. Медкова «Способ диагностики коклюша и определения авирулентных мутантов возбудителя и диагностический набор» №2011120790 от 24.05.2011г.

Список сокращений

АКДС – адсорбированная коклюшно-дифтерийно-столбнячная вакцина

ГЭ – геном-эквивалент

ИФА – иммуноферментный анализ

КОЕ – колониеобразующая единица

МКБ-10 – Международная классификация болезней десятого пересмотра

МОЕ – международные оптические единицы

ПЦР-РВ – полимеразная цепная реакция в режиме реального времени

РНГА – реакция непрямой гемагглютинации

РПГА – реакция прямой гемагглютинации

Вvg – bordetella virulence gene

dNTP – дезокситрифосфаты

IS – inserted sequence


БЛАГОДАРНОСТИ

Считаю своим приятным долгом выразить глубокую благодарность научным руководителям Г.И. Каратаеву и А.Г. Боковому за постоянное внимание, всестороннюю помощь, полученные знания и навыки.

За предоставленную возможность работать на приборе АНК-32 благодарю руководителя лаборатории хламидиозов ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России д.б.н. Зигангирову Н.А. Искренне признательна Ю.С. Аляпкиной и руководству ЗАО «Синтол» за оказанное содействие и большую помощь в разработке тест-системы ПЦР-РВ на начальных этапах работы. За многочисленные советы, помощь в проверке и отработке тест-системы, в организации проведения ПЦР-РВ, за прочтение рукописи диссертации, сделанные ценные замечания благодарю Ю.П. Пашко. Глубокую признательность выражаю заведующей отделением подопытных животных ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России Ветковой Л.Г. за решение организационных вопросов и неоценимую помощь при работе с животными. За предоставленные препараты ДНК, выделенной из назофарингеальных смывов от детей с клиническим диагнозом «Коклюш», благодарю д.м.н. Борисову О.Ю.

За всестороннюю помощь в работе, прочтение рукописи диссертации, ценные критические замечания и советы, поддержку выражаю глубокую благодарность Синяшиной Л.Н. За полученные знания, навыки, умения, поддержку благодарю Амелину И.П., Семина Е.Г., Алешкина Г.И., Смирнова Г.Б., Маркова А.П., Большакову Т.Н. Отдельную благодарность выражаю Корольковой Г.М. и Сильченко М.П.

Глубокую благодарность выражаю администрации ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России за предоставленную возможность заниматься научной работой и оказанное содействие в организации и проведении научных исследований.

Искреннюю благодарность и признательность выражаю ученому секретарю диссертационного совета ФГБУ НИИЭМ им. Н.Ф. Гамалеи Минздрава России д.м.н., проф. Русаковой Е.В., а также Асратян А.А., Гащенко Т.А. и Кожевниковой Л.К. за помощь при подготовке диссертации к защите.



 



<
 
2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.