WWW.DISUS.RU

БЕСПЛАТНАЯ НАУЧНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

  елистратова елена владимировна распределение аберрантно метилированных форм генов опухолевой супрессии в циркулирующих днк крови больных раком желудка   14.00.14 - онкология 03.00.04 - биохимия ...

На правах рукописи

 

Елистратова Елена Владимировна

РАСПРЕДЕЛЕНИЕ АБЕРРАНТНО МЕТИЛИРОВАННЫХ ФОРМ ГЕНОВ ОПУХОЛЕВОЙ СУПРЕССИИ В ЦИРКУЛИРУЮЩИХ ДНК КРОВИ БОЛЬНЫХ РАКОМ ЖЕЛУДКА

 

14.00.14 - онкология

03.00.04 - биохимия

Автореферат

диссертации на соискание ученой степени

кандидата медицинских наук

 

Томск-2008

Работа выполнена в ГУ Научно-исследовательский институт онкологии Томского научного центра Сибирского отделения Российской Академии Медицинских наук и Институте химической биологии и фундаментальной медицины Сибирского отделения Российской Академии наук.

Научные руководители:

Доктор медицинских наук,

профессор Тузиков Сергей Александрович

Кандидат биологических наук Рыкова Елена Юрьевна

Официальные оппоненты:

Доктор биологических наук,

профессор Чердынцева Надежда Викторовна

Доктор медицинских наук,

профессор Тихонов Виктор Иванович

Ведущая организация: ГУ Российский онкологический научный центр им. Н.Н. Блохина РАМН

Защита диссертации состоится «___» __________ 2008 г. в _____ часов на заседании диссертационного совета Д 001.032.01 при ГУ НИИ онкологии ТЦН СО РАМН по адресу: 634009, г. Томск, пер. Кооперативный, 5.

С диссертацией можно ознакомиться в библиотеке ГУ НИИ онкологии ТНЦ СО РАМН

Автореферат разослан «___» ___________________ 2008 г

Ученый секретарь

диссертационного совета,

доктор медицинских наук Фролова И.Г.

Актуальность проблемы. Рак желудка (РЖ) является четвертой по частоте формой злокачественных новообразований и занимает второе место в структуре общей летальности от злокачественных новообразований (Parkin M. et al., 2005). Статистические данные объясняются поздним выявлением РЖ, когда основной метод радикального лечения этого заболевания, а именно хирургический, является мало эффективным (Симонов Н.Н. с соавт., 2001). Совершенно очевидно, что решения проблемы ранней диагностики рака желудка необходимы надежные и простые методы детекции опухолевого процесса, которые позволяли бы выявлять опухоль на доклинических стадиях. Известно, что трансформация клеток в раковые и прогрессия онкологического процесса связаны с накоплением генетических и эпигенетических изменений в геноме (Lengauer C. et al., 1998, Egger G. et al., 2004). На сегодняшний день известно, что аберрантное метилирование ДНК является одним из наиболее распространенных и ранних событий, приводящих к опухолевой трансформации клетки при новообразованиях различной локализации, в том числе и при раке желудка (Esteller M., 2005). С наибольшей частотой в опухолевой ткани при раке желудка распространено аберрантное метилирование трех генов опухолевой супрессии: p15, hMLH1, MGMT (Sato F. et al., 2006, Leung W.K. et al., 2001, Carvalho B. et al., 2003), что открывает большие возможности для разработки методов ранней диагностики рака желудка. Однако, проведение исследования ткани опухоли возможно лишь при визуально детектируемом изменении слизистой оболочки желудка, и, таким образом, этот метод не может быть использован ни для выявления ранних стадий развития опухолей, ни для мониторинга рецидивов. Наиболее перспективным представляется малоинвазивное выявление ДНК-онкомаркеров в крови. Разработка таких методов анализа стала возможной сравнительно недавно, когда было обнаружено, что в составе свободно циркулирующих ДНК (цирДНК) плазмы крови больных выявляются изменения (генетические и эпигенетические), идентичные изменениям ДНК в клетках опухоли (Anker P., 2003). Такие онкоспецифические ДНК присутствуют в крови в низкой концентрации, что приводит к более низкой частоте выявления эпигенетических маркеров в плазме крови больных раком желудка по сравнению с частотой их выявления в образцах опухолевой ткани (Lee T-L. et al., 2002).

В настоящее время получены убедительные данные, демонстрирующие, что внеклеточные ДНК не только свободно циркулируют в плазме крови, но также могут быть связаны с поверхностью форменных элементов крови (Laktionov P.P. et al., 2004). Особый интерес вызвал тот факт, что в составе цирДНК, связанных с клеточной поверхностью, как и в ДНК плазмы, обнаруживаются онкоспецифические последовательности ДНК (Rykova E.Y. et al., 2004). Эти данные позволяют надеяться, что проблема более низкой частоты детекции гиперметилированных генов опухолевой супрессии в крови по сравнению с исследованием опухолевой ткани при раке желудка может быть успешна преодолена. Все сказанное определяет актуальность исследования распределения аберрантного метилирования генов опухолевой супрессии в циркулирующих ДНК крови больных раком желудка.

Цель исследования. Изучение особенностей циркуляции внеклеточных ДНК и распределения онкоспецифических последовательностей в крови больных раком желудка с разными клинико-морфологическими параметрами течения заболевания

Задачи исследования:

  1. Определить концентрацию цирДНК и изучить распределение между фракциями плазмы и связанных с клеточной поверхностью форменных элементов крови у больных раком желудка на разных стадиях заболевания.
  2. Проанализировать частоту выявления аберрантно метилированных форм генов опухолевой супрессии p15, MGMT, hMLH1 в цирДНК плазмы и фракции связанной с поверхностью клеток крови у больных раком желудка на разных стадиях заболевания.
  3. Провести сравнительное исследование чувствительности и специфичности анализов эпигенетических маркеров (p15, MGMT, hMLH1) в цирДНК и стандартных онкоспецифических белков (РЭА, СА 19.9, СА 72.4) при раке желудка.

Научная новизна.

Впервые показано, что по мере распространенности рака желудка происходит достоверное увеличение концентрации цирДНК плазмы, тогда как концентрация цирДНК, связанных с клеточной поверхностью, достоверно не изменяется.

Получены новые данные о возможности выявления у больных раком желудка онкоспецифических последовательностей в цирДНК, связанных с клеточной поверхностью, что значительно повышает частоту выявления эпигенетических маркеров по сравнению с использованием только цирДНК плазмы. Показано, что аберрантное метилирование является характерным изменением для всех исследуемых стадий рака желудка.

Между детекцией эпигенетических маркеров и повышенным уровнем опухолеспецифических белков (РЭА, СА 19.9 и СА 72.4) отсутствует корреляционная зависимость, таким образом, данные изменения имеют независимое значение при развитии рака желудка и отражают разные стороны патогенеза.

Теоретическая и практическая значимость.

Достоверное увеличение концентрации цирДНК плазмы у больных раком желудка по мере распространения опухолевого процесса свидетельствуют о том, что анализ концентрации цирДНК плазмы является эффективным показателем при дифференцировке больных раком желудка и могут быть использованы для оценки стадии заболевания.

Суммарная цирДНК, а именно ДНК плазмы и связанная с клеточной поверхностью, повышает чувствительность детекции метилированных аллелей генов опухолевой супрессии (MGMT, p15, hMLH1) по сравнению с использованием только цирДНК плазмы у больных раком желудка.

Положения, выносимые на защиту.

  1. У больных раком желудка по мере распространенности заболевания статистически значимо возрастает уровень цирДНК плазмы. В то время как уровень цирДНК, связанных с клеточной поверхностью, не изменяется.
  2. При раке желудка использование суммарных цирДНК крови позволяет детектировать опухолевые изменения (метилирование аллелей генов р15 и hMLH1) с чувствительностью 63% и специфичностью 63%. Метилированные формы генов выявляются в суммарных цирДНК при раке желудка с одинаковой частотой на разных стадиях заболевания.
  3. При раке желудка частота выявления ДНК-маркеров (метилированных аллелей генов MGMT, p15 и hMLH1) существенно выше по сравнению с выявлением повышенного уровня белковых маркеров РЭА, CA 19.9 и CA 72.4. Показано отсутствие достоверной корреляции между детекцией эпигенетических и белковых маркеров опухолевого процесса.

Публикации и апробация работы. По материалам диссертации опубликовано 3 статьи и 17 тезисов. Результаты работы были представлены на конференциях «Современное состояние и перспективы развития экспериментальной и клинической онкологии» (Россия, 2004), «Biotechnology and oncology» и «Новые технологии в онкологической практике» (Россия, 2005), «Петровские чтения-2006» и «Актуальные вопросы экспериментальный и клинической онкологии» (Россия, 2006), «Фундаментальные науки-медицине», XI Российский Онкологический конгресс и II Молодежный Медицинский Конгресс «Санкт-Петербургские научные чтения» (Россия, 2007).

Структура и объем диссертации. Диссертация состоит из глав: «Введение», «Обзор литературы», «Материалы и методы», «Результаты исследования и их обсуждение», «Заключение», «Выводы», «Список литературы». Работы изложена на 93 страницах машинописного текста (12 шрифт, двойной интервал), содержит 11 рисунков и 19 таблиц. Библиография включает 127 литературных источников.

СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы исследования.

Характеристика группы больных.

В исследование было включено 60 больных раком желудка (средний возраст 64±9 лет) T1-4N0-3M0-1, первично поступивших в хирургическое отделение Новосибирского областного онкологического диспансера с 2003-2008 год (табл. 1). Стадия онкологического процесса определялась в соответствии с Международной классификации опухолей по системе TNM (ВОЗ, 1990). Формирование группы осуществлялось после постановки диагноза на основании клинического, морфологического, эндоскопического, рентгенологического обследования и по результатам оперативного вмешательства.

В зависимости от распространенности онкологического процесса и гистологического типа из группы больных раком желудка были сформированы две подгруппы. В подгруппу больных с неблагоприятным прогнозом вошли пациенты IIIб-IV стадии заболевания и с морфологически подтвержденным перстневидноклеточным типом рака. Подгруппу больных с благоприятным прогнозом составили пациенты I-IIIa стадии онкологического процесса и с морфологически подтвержденными аденокарциномой разной степени дифференцировки и недифференцированным типами рака.

Контрольную группу составили 30 клинических здоровых людей – доноров отделения переливания крови Центральной Клинической Больницы Советского района г. Новосибирска (средний возраст группы 48±2 г.).

Таблица 1

Характеристика группы больных РЖ

Клинико-патологические характеристики Частота встречаемости (количество человек n=60)
Пол Мужской Женский 36 (60%) 24 (40%)
Возраст <60 >60 36 (60%) 24 (40%)
Стадия Т1 T2 T3 T4 N0 Nx,1-2 Mo M1 Iа Iб II IIIа IIIб IV 1 (2%) 28 (46%) 18 (30%) 13 (22%) 25 (42%) 35 (58%) 46 (77%) 14 (23%) 1 (2%) 20 (33%) 8 (13%) 13 (22%) 1 (2%) 17 (28%)
Гистотип Аденокарцинома разной степени дифференцировки Недифференцированный рак Перстневидноклеточный рак 36 (60%) 15 (25%) 9 (15%)

Работа проводилась с соблюдением принципов добровольности и конфиденциальности в соответствии с «Основами законодательства РФ об охране здоровья граждан» (указ Президента РФ от 24.12.1993 № 2288). Получено разрешение этического комитета НИИ онкологии ТНЦ СО РАМН.

Методы исследования.

Образцы венозной крови собирали в антикоагуляционный раствор. Для выделения цирДНК плазмы и связанных с клеточной поверхностью форменных элементов, обработку образцов крови производили методом двухстадийной элюции, а именно, последовательной обработкой форменных элементов крови фосфатным буфером, содержащим ЭДТА (ФБ-ЭБТА элюат) и раствором трипсина в условиях, не приводящих к лизису клеток (трипсиновый элюат) ( Laktionov P.P. et al., 2004).

Выделение цирДНК из плазмы и из фракций, связанных с клеточной поверхностью для исследования концентрации проводили методом сорбции на модифицированном мелкодисперсном стекле (Лактионов П.П. с соавт. 2006). Концентрацию цирДНК в анализируемых образцах определяли при помощи флуоресцирующего интеркалирующего красителя Hoechst 33258. Для исследования статуса метилирования генов опухолевой супрессии циркулирующие ДНК крови выделяли из образцов плазмы и суммарного элюата с клеточной поверхности с использованием коммерческих наборов для выделения ДНК из плазмы крови (БиоСилика, Россия) согласно инструкциям от производителя. Метилирование промоторных областей генов MGMT, p15, hMLH1 в цирДНК исследовали методом ПЦР, специфичной к метилированию, после бисульфитной модификации ДНК (табл. 2). Продукты амплификции анализировали с помощью электрофореза в 6 % ПААГ в стандартных условиях.

Концентрацию белковых маркеров в плазме измеряли иммуноферментным анализом при помощи коммерческих наборов РЭА, CA 19.9 (Вектор-Бест, Россия), СА 72.4 (DRG, Германия) согласно инструкциям от производителя. Верхние границы нормы были установлены согласно рекомендациям фирм-производителей коммерческих наборов. Для РЭА верхняя граница нормы составила 5 нг/мл, для СА 19.9 – 37 ед/мл и для СА 72.4 - 6 ед/мл.

Для статистической обработки данных использовался пакет про­грамм STATISTICA® 6.0. Для статистической обработки данных были использованы следующие методы: критерий Стьюдента для независимых переменных - для оценки различий групп с нормальном распределением признака; критерий Манна-Уитни - для оценки различий между группами при отсутствии нормального распределения признака; односторонний критерий Фишера - для оценки различий групп по качественным признакам. Для оценки тесноты (силы) связи между переменными рассчитывался коэффициент ранговой корреляции Спирмена. Различия считались достоверными при p<0,05.

Таблица 2

Последовательности праймеров, специфичные к метилированной (М) и неметилированной (U) формам генов MGMT, hMLH1, p15

Ген M/U Последовательности праймеров Размер (пн) Tm (°C) Кол-во циклов
P15 P15 hMLH1 MGMT M M M U прямой (5'-3') TTTCGACGTTCGTAGGTTTTCGC обратный (5'-3') GCACTCTTCCGAAAACGAAACG прямой (5'-3') TATATCGTTCGTAGTATTCGTGT обратный (5'-3') TCCGACCCGAATAAACCCAA прямой (5'-3' ) GCGTTCGTATTTTGCGGTT обратный (5'-3') CGTACAATAACCGAACGACCGA прямой (5'-3') TGTGATGTGTTTGTATTTTGTGGTT обратный (5'-3') CCATACAATAACCAAACAACCAA 81 153 147 154 69 56 64 60 35 40 35 40

Собственные результаты и их обсуждение.

Концентрация циркулирующих ДНК в плазме клинически здоровых людей варьировала от 0 до 28 нг/мл и в среднем составляла 10 нг/мл. Концентрация цирДНК плазмы здоровых мужчин (среднее значение 13 нг/мл) достоверно не отличалась от концентрации цирДНК плазмы здоровых женщин (8 нг/мл) (p=0,1) (табл. 3). Полученные нами значения согласуются с данными других авторов, измерявших концентрацию цирДНК в крови здоровых доноров (Fleischhacker M. et al., 2007).

Нами было обнаружено, что в крови клинически здоровых людей основная часть (в среднем 97%) цирДНК связана с поверхностью форменных элементов крови. При этом даже если в плазме цирДНК не были выявлены, значительное количество нуклеиновых кислот было обнаружено на поверхности форменных элементов крови. Достоверной корреляции между концентрацией цирДНК, связанных с клеточной поверхностью, и количеством форменных элементов клеток крови (лейкоцитов, эритроцитов, тромбоцитов) по критерию Спирмена не обнаружено.

Общая концентрация связанных с поверхностью клеток нуклеиновых кислот была достоверно выше у мужчин (среднее значение 703 нг/мл), чем у женщин (429 нг/мл) при сравнении выборок по критерию Манна-Уитни (p=0,04) (табл. 3). Исходя из представленных данных о корреляции концентрации циркулирующих нуклеиновых кислот на поверхности клеток с полом у клинически здоровых людей, становится ясно, что при исследовании уровня циркулирующих ДНК, связанных с клеточной поверхностью, при различных патологиях необходимо учитывать пол пациента.

У больных раком желудка концентрация циркулирующих ДНК в плазме крови варьировала от 8 до 537 нг/мл, и в среднем составляла 99 нг/мл крови. У больных раком желудка мужчин среднее значение концентрации цирДНК плазмы составляло 116 нг/мл, для женщин данный показатель составил 77 нг/мл (табл. 3). Концентрация цирДНК в плазме больных мужчин достоверно не отличалась от концентрации ДНК в плазме больных женщин (критерий Манна-Уитни p>0,05).

Суммарная концентрация цирДНК, связанных с клеточной поверхностью, выделенных из фракций ФБ-ЭДТА и трипсинового элюата, у больных раком желудка составила в среднем 547 нг/мл и достоверно не отличалась между мужчинами (442 нг/мл) и женщинами (685 нг/мл) (критерий Манна-Уитни p>0,05) (табл. 3).

При сравнении концентрации цирДНК плазмы нами было показано, что концентрация цирДНК у больных раком желудка (99 нг/мл) достоверно выше по сравнению с контрольной группой (10 нг/мл) (критерий Манна-Уитни p=0,001).

Таблица 3

Концентрации цирДНК в крови клинически здоровых людей и больных раком желудка*

Пол ЦирДНК* плазмы Связанные с поверхность клеток цирДНК*
Здоровые Муж. 13 (М 14, Д 0-25) 703 (М 715, Д 190-1520)
Жен. 8 (М 6, Д 0-28) 429 (М 354, Д 121-871)
Больные РЖ Муж. 116 (М 64, Д 8-527) 442 (М 457, Д 14-1464)
Жен. 77 (М 63, Д 10-1946) 685 (М 523, Д 74-1855)

* Концентрация цирДНК представлена в нг/мл крови

М- медиана нг/мл

Д- диапазон нг/мл

У больных раком желудка мужчин отмечалось снижение концентрации цирДНК, связанных с клеточной поверхностью, по сравнению со здоровыми мужчинами (табл. 3, критерий Манна-Уитни p=0,04). Было выявлено также снижение процента цирДНК, связанных с поверхностью клеток крови, от общего количества цирДНК (сумма цирДНК плазмы и связанных с поверхностью клеток крови) (в среднем 76% у больных и 98% у здоровых доноров, критерий Манна-Уитни p=0,01). У больных РЖ женщин показано отсутствие достоверных отличий концентрации цирДНК, связанных с клеточной поверхностью (табл. 3, критерий Манна-Уитни p>0,05), и их процента от суммарных цирДНК по сравнению с клинически здоровыми женщинами (87% и 97%, соответственно, критерий Манна-Уитни p>0,05).

Проведенные ранее исследования особенностей распределения в крови циркулирующих ДНК больных раком легкого и молочной железы выявили другие закономерности (Tamkovich S.N. et al., 2005, 2008). В данной работе показано, что выявленные нами изменения количества и распределения циркулирующих ДНК крови при раке желудка у мужчин и женщин являются характерными именно для этого заболевания.

С помощью построения характеристической кривой (ROC-анализ), мы выбрали пороговое значение концентрации цирДНК плазмы 25 нг/мл, при котором рак желудка с максимальной специфичностью и чувствительностью можно отличить от клинической нормы (рис. 1).

Рис. 1. ROC- кривая чувствительности и специфичности концентрации цирДНК у больных РЖ.

Корреляционные связи концентрации цирДНК с клинико-патологическими параметрами не отличались при анализе в группах больных РЖ мужчин и женщин. Поэтому дальнейшее исследование особенностей циркуляции внеклеточных ДНК было проведено в объединенной группе больных РЖ независимо от пола.

В подгруппах больных РЖ, сформированных по критерию распространенности онкологического процесса, было обнаружено, что среднее значение концентрации цирДНК плазмы у больных с неблагоприятными факторами прогноза (146 нг/мл) было достоверно повышено по сравнению с подгруппой с благоприятным прогнозом (72 нг/мл) (критерий Манна-Уитни p=0,04) (табл. 4).

При анализе корреляций концентрации цирДНК в плазме больных раком желудка с клинико-патологическими параметрами опухоли (TNM, гистологический тип опухоли) достоверное повышение концентрации цирДНК плазмы (критерий Манна-Уитни p=0,049) было обнаружено в группе больных с отдаленными метастазами по сравнению с группой, в которой они отсутствуют (155 нг/мл и 79 нг/мл, соответственно) (табл. 5), так же как и при перстневидноклеточном типе опухоли по сравнению с аденокарциномой (р=0,03) и недифференцированным раком (р=0,04) (табл. 6).

Таблица 4

Зависимость концентрации цирДНК в крови больных раком желудка от распространенности онкологического процесса*

Стадия ЦирДНК* плазмы Связанные с поверхностью клеток цирДНК*
I-IIIa 72 (М 43, Д 8-297) 545 (М 457, Д 62-1855)
IIIб-IV 146 (М 128, Д 10-527) 562 (М 594, Д 74-1464)

* Концентрация цирДНК представлена в нг/мл крови

М- медиана нг/мл

Д- диапазон нг/мл

Таблица 5

Зависимость концентрации цирДНК в крови больных раком желудка от наличия отдаленных метастазов*

Метастазы ЦирДНК* плазмы Связанные с поверхностью клеток цирДНК*
M1,X 155 (М 100, Д 30-527) 550 (М 544, Д 131-1464)
M0 79 (М 45 Д 8-297) 552 (М 468, Д 62-1855)

* Концентрация цирДНК представлена в нг/мл крови

М- медиана нг/мл

Д- диапазон нг/мл

Таблица 6

Зависимость концентрации цирДНК в крови больных раком желудка от гистологического типа опухоли*

Гистотип ЦирДНК* плазмы Связанные с поверхностью клеток цирДНК*
АК 71 (М 38, Д 10-278) 431 (М 344, Д 62-1464)
Недифф. 90 (М 56, Д 8-297) 724 (М 493, Д 124-1855)
Перстн. 204 (М 159, Д 71-527) 623 (М 608, Д 114-1101)

* Концентрация цирДНК представлена в нг/мл крови

М- медиана нг/мл

Д- диапазон нг/мл

Достоверных корреляций между концентрацией цирДНК, связанных с клеточной поверхностью форменных элементов, и распространенностью онкологического процесса нами не было выявлено.

Таким образом, нами было показано, что у больных раком желудка концентрация цирДНК плазмы достоверно отличается от клинической нормы, от злокачественных новообразований другой локализации (рака молочной железы и рака легкого), и увеличивается по мере распространенности онкологического процесса. Очевидно, что для дальнейшей оценки диагностической значимости данных о распределении цирДНК в крови для диагностики рака желудка и мониторинга рецидивов необходимы дальнейшие исследования концентрации цирДНК в крови больных предраковыми заболеваниями желудка и в крови больных пролеченных по поводу рака желудка.

Обнаружение значительного количества связанных с поверхностью форменных элементов крови циркулирующих ДНК при раке желудка позволило нам использовать их в качестве исходного материала для выявления онкоспецифических последовательностей, а именно аберрантного метилирования генов опухолевой супрессии в крови больных раком желудка.

Нами проанализирован статус метилирования промоторных областей генов опухолевой супрессии p15, MGMT и hMLH1 в цирДНК плазмы и связанных с клеточной поверхностью в крови больных раком желудка и клинически здоровых людей. Метилированные формы данных генов с наибольшей частотой встречаются в ДНК ткани опухоли и цирДНК плазмы при раке желудка и с наименьшей частотой у здоровых людей (рис. 2).

 Диапазон частоты встречаемости метилированых форм генов p15, MGMT,-2

Рис. 2. Диапазон частоты встречаемости метилированых форм генов p15, MGMT, hMLH1 в ткани слизистой желудка в норме и в опухолевой ткани при раке желудка согласно литературным данным.

Согласно полученным результатам в образцах цирДНК плазмы метилированная форма гена p15 встречалась у 20% больных раком желудка. В объединенной фракции цирДНК, элюированных с клеточной поверхности форменных элементов, изменение статуса метилирования гена p15 нами детектировалось у 43% онкологических больных, что значительно чаще, чем в цирДНК плазмы. У здоровых людей метилированная форма этого гена обнаруживалась в цирДНК плазмы в 13% случаев и в цирДНК, связанных с клеточной поверхностью, в 13%.

Частота детекции метилированной формы гена p15 возрастала при суммарном анализе результатов, полученных при исследовании цирДНК плазмы и цирДНК, связанных с клеточной поверхностью форменных элементов крови. При этом в группе больных раком желудка аберрантное метилирование гена p15 выявлено в 50% случаев, в группе людей без диагностированных патологий в 23% случаев.

Изменение статуса метилирования промоторной области гена hMLH1 было обнаружено в 13% образцов цирДНК плазмы и 20% образцов цирДНК, выделенных из элюатов с поверхности клеток крови больных раком желудка.

При исследовании метилирования промоторных участков гена hMLH1 как в цирДНК плазмы, так и в цирДНК, связанных с клеточной поверхностью, аберрантное метилирование мы детектировали у 13% здоровых доноров. Метилированная форма этого гена при суммарном анализе данных, полученных при исследовании цирДНК плазмы и связанных с клеточной поверхностью, встречалась у 27% больных и у 17% здоровых людей.

В ходе наших экспериментов метилированная форма промоторной области гена MGMT была обнаружена в 37% образцов цирДНК, выделенных из плазмы больных раком желудка. Аберрантное метилирование промоторных участков генов MGMT в образцах цирДНК, связанных с клеточной поверхностью, мы наблюдали у 57% больных раком желудка. У здоровых доноров частота встречаемости этого изменения в цирДНК плазмы и связанных с клеточной поверхностью составила 27% и 30%, соответственно.

Частота встречаемости метилированной формы гена MGMT при суммарном анализе цирДНК плазмы и связанных с поверхностью клеток крови возрастала до 67% у онкологических больных и 43% у здоровых доноров.

Суммарные данные о частоте выявления метилированных форм генов опухолевой супрессии p15, hMLH1, MGMT в крови больных раком желудка и здоровых доноров представлены на рисунке 3.

Рис. 3. Частота выявления метилированных форм генов опухолевой супрессии p15, hMLH1, MGMT в крови больных раком желудка и здоровых доноров.

По нашим данным частота встречаемости метилированных форм всех исследуемых генов в цирДНК плазмы оказалась значительно ниже, чем частота встречаемости в ткани опухоли при раке желудка обнаруженная другими исследователями. При анализе суммарных цирДНК как в плазме, так и связанных с поверхностью клеток, частота выявления метилированных форм генов в наших экспериментах существенно возрастала и соответствовала результатам других исследований, посвященных анализу ДНК опухолевых тканей (Sato F. et al., 2006). Таким образом, использование суммарных цирДНК (объединенные фракции плазмы, ФБР/ЭДТА и трипсинового элюатов) значительно повышало чувствительность детекции метилированных формы генов MGMT, p15 и hMLH1.

При определении статуса метилирования генов MGMT, p15 и hMLH1 в суммарной цирДНК крови, рак желудка выявлялся с чувствительностью 80% и специфичностью 33%. Низкая специфичность определяется высокой частотой детекции аберрантного метилирования гена MGMT у клинически здоровых людей (43%). Анализ метилирования этого участка гена является, по-видимому, мало перспективным для разработки первичной диагностики рака желудка. Комбинированное определение аберрантно метилированных аллелей генов р15 и hMLH1 в суммарных цирДНК крови позволило нам выявлять рак желудка с чувствительностью 63% и специфичностью 63%.

Нами не выявлено достоверных корреляций частоты встречаемости метилированных форм промоторной области гена p15 и hMLH1 с клинико-патологическими параметрами больных раком желудка. Однако было обнаружено, что частота встречаемости метилированной формы гена MGMT возрастала с распространенностью онкологического процесса (стадией опухоли), что соответствует приводимым в литературе данным (Park T.J. et al., 2001) (табл. 7).

В работе была поставлена задача определить на каком из этапов развития опухоли выявляется гиперметилирование генов опухолевой супрессии в цирДНК крови больных раком желудка. Было обнаружено, что у 71% больных раком желудка, находящихся на Т2 стадии детектируется изменение статуса метилирования хотя бы одного из трех исследуемых генов. Метилированная форма одного из трех генов была выявлена среди больных, не имеющих метастазы в регионарные лимфатические узлы в 67% случаев, и у 75% больных без отдаленных метастазов. Выявлена тенденция увеличения частоты встречаемости метилированной формы одного из трех генов с прогрессией опухолевого процесса, однако достоверных корреляций обнаружено не было. Таким образом, аберрантное метилирование генов опухолевой супрессии характерно для всех исследованных стадий развития опухоли.

Несмотря на возрастающий интерес к малоинвазивным методам диагностики онкологических заболеваний, в настоящее время до клинического применения доведено только несколько иммунохимических анализов. Метод иммунохимического анализа онкомаркеров РЭА, СА 72.4, СА 19.9, используемый в практической онкологии, имеет только вспомогательное значение для диагностики рака желудка, так как, несмотря на относительно высокую специфичность (до 98%), не обладает достаточной чувствительностью (не более 60%) (Mattar R. et al., 2002). Третье задачей работы было сравнение чувствительности и специфичности анализов эпигенетических и белковых маркеров, поэтому мы определяли уровни белковых маркеров РЭА, СА 19.9, СА 72.4 в крови тех же больных раком желудка и здоровых людей, у которых исследовали профиль метилирования генов.

Таблица 7

Частота встречаемости аберрантного метилирования генов p15, MGMT, hMLH1 в цирДНК и клинико-патологические параметры больных раком желудка

Клинико-патологические параметры Частота метилирования (№)
число P15 MGMT hMLH1 1 ген
Общее число 30 15 (50%) 20 (67%) 8 (27%) 24 (80%)
Пол мужской женский 19 11 9 (53%) 6 (55%) 10 (53%) 10 (91%) 6 (37%) 2 (18%) 14 (79%) 10 (91%)
Возраст <60 >60 11 19 6 (55%) 9 (47%) 9 (82%) 11 (58%) 2 (18%) 6 (32%) 9(82%) 15 (79%)
Стадия T2 T3 T4 N0 Nx,1-2 Mo M1 Iа Iб II IIIа IIIб IV 14 10 6 12 18 24 6 0 9 7 6 1 7 6 (43%) 6 (60%) 3 (50%) 4 (33%) 11 (61%) 12 (50%) 3 (50%) 0 3 (33%) 4 (57%) 3 (50%) 1 (100%) 4 (57%) 8 (57%) 7 (70%) 5 (83%) 7 (58%) 13 (72%) 15(63%) 5 (83%) 0 4 (44%) 6 (86%) 3 (50%) 1 (100%) 6 (86%) 5 (36%) 2 (20%) 1 (17%) 4 (33%) 4 (22%) 7 (29%) 1 (17%) 0 3 (33%) 3 (43%) 1 (17%) 0 1 (14%) 10 (71%) 8 (80%) 6 (100%) 8 (67%) 16 (89%) 18 (75%) 6 (100%) 0 5 (56%) 7 (100%) 4 (67%) 1 (100%) 6 (86%)
Гистотип АК Недифф. Перстн. 20 6 4 7 (35%) 5 (83%) 3 (75%) 12 (60%) 4 (67%) 4 (100%) 6 (30%) 2 (33%) 0 (0%) 14 (70%) 6 (100%) 4 (100%)

Согласно полученным данным метод, основанный на определении уровня белковых маркеров в плазме больных РЖ, характеризуется высокой специфичностью (100%), однако даже при комбинированном исследовании маркеров СА 19.9, СА 72.4 его чувствительность не превышает 30%. Исследовании РЭА в комбинации с СА 19.9 и СА 72.4 не повышает чувствительность, но лишь ведет к потере специфичности до 85% (табл. 8).

Таблица 8

Характеристики методов, основанных на определении уровня белковых маркеров

Характеристика метода РЭА СА 19.9 СА 72.4 СА 19.9 +СА 72.4 СА 19.9 +СА 72.4 + РЭА
Чувствительность Специфичность 5% 85% 15% 100% 15% 100% 30% 100% 30% 85%

В нашем исследовании частота встречаемости повышенного уровня СА 72.4 в группе больных с неблагоприятным прогнозом была достоверно выше по сравнению с группой больных с благоприятным прогнозом (критерий Фишера p=0,03) (табл. 9), а определение маркеров СА 19.9 и РЭА не имело прогностической значимости. Достоверных корреляций повышения уровней белковых маркеров с клинико-патологическими параметрами больных РЖ нами не было выявлено.

Таблица 9

Встречаемость повышенного уровня белковых маркеров в группах больных в зависимости от распространенности онкологического процесса

Стадия СА19.9+ СА 72.4 CA 19.9 CA 72.4** РЭА
+ n*=6 ---- n=14 + n=4 ----n=16 + n=3 ---- n=17 + n=1 ---- n=19
IIIб - IV I - IIIа 4 2 3 11 2 2 5 11 3 0 4 13 0 1 7 12

*n- количество людей.

**- p=0,03

+ повышенный уровень белкового маркера

--- уровень белкового маркера в границах нормы

Проведение сравнительного анализа показало, что чувствительность метода, основанного на определении частоты встречаемости иммунохимических маркеров, существенно ниже по сравнению с анализом ДНК-маркеров (рис. 4).

Следует отметить, что достоверных корреляций между наличием аберрантного метилирования генов опухолевой супрессии MGMT, p15 и hMLH1 и повышенным уровнем иммунохимических маркеров РЭА, СА 19.9 и СА 72.4 в крови больных раком желудка нами обнаружено не было. Это свидетельствует о том, что данные параметры имеют независимое значение при развитии рака желудка и отражают разные стороны патогенеза.

ВЫВОДЫ

  1. У больных раком желудка концентрация цирДНК плазмы крови мужчин и женщин достоверно выше, чем у здоровых доноров и составляет 116 нг/мл и 77 нг/мл против 10 нг/мл, соответственно (р=0,001). У больных раком желудка мужчин уровень цирДНК, связанных с поверхностью клеток крови, достоверно ниже по сравнению со здоровыми донорами (442 нг/мл и 703 нг/мл, соответственно, p=0,04).
  2. При IIIб-IV стадии выявлено достоверное увеличение концентрации цирДНК плазмы по сравнению с больными I-IIIa стадии заболевания (146 нг/мл и 72 нг/мл, соответственно, p=0,04). У больных с отдаленными метастазами концентрация цирДНК плазмы в группе была достоверно выше по сравнению с группой больных без отдаленных метастазов (155 нг/мл и 79 нг/мл, соответственно, p=0,049).
  3. В крови больных раком желудка при суммарном анализе цирДНК плазмы и связанных с клеточной поверхностью, аберрантно метилированная форма гена p15 детектируется в 50%, MGMT в 67% и hMLH1 в 27% случаев, что значительно превышает частоту их выявления в цирДНК плазмы (20%, 37% и 13% соответственно). У больных раком желудка метилированные аллели одного из двух генов р15 и hMLH1 в цирДНК крови выявляются со специфичностью и чувствительностью 63% и 63%. При раке желудка метилированные формы генов выявляются в суммарных цирДНК с одинаковой частотой на разных стадиях заболевания.
  4. У больных раком желудка частота выявления метилированных форм генов p15 и hMLH1 в суммарных цирДНК выше по сравнению с определением стандартных белковых маркеров РЭА, СА 19.9, СА 72.4 (63% и 30%, соответственно). Не выявлено статистически значимой корреляции между эпигенетическими и белковыми маркерами.

Список работ, опубликованных по теме диссертации

  1. Колесникова Е.В. Исследование внеклеточных нуклеиновых кислот в крови здоровых доноров и больных с онкологическими заболеваниями желудочно-кишечного тракта [Текст] / Е.В. Колесникова, О.Е. Брызгунова, С.Н. Тамкович // Материалы XLII Международной научной студенческой конференции «Студент и научно-технический прогресс». – Новосибирск. – 2004. - С. 20-21.
  2. Колесникова Е.В. Внеклеточные нуклеиновые кислоты крови здоровых доноров и больных с опухолями ЖКТ [Текст] / С.Н. Тамкович, П.П. Лактионов, О.Е. Брызгунова, Е.В. Колесникова, П.И. Шелестюк, Е.Ю. Рыкова, В.В. Власов // Российская научно-практическая конференция «Современное состояние и перспективы развития экспериментальной и клинической онкологии». – Томск. - 2004. - С. 248-249.
  3. Колесникова Е.В. Исследование внеклеточных нуклеиновых кислот в плазме крови у больных раком желудка и толстой кишки [Текст] / Е.В. Колесникова, Е.А. Гудошникова, О.Е. Брызгунова // Ежегодная конкурс-конференция студентов и молодых ученых «Авиценна - 2004». – Новосибирск. – 2004. – С. 90-90.
  4. Колесникова Е.В. Циркулирующие нуклеиновые кислоты в крови больных раком желудка и толстой кишки [Текст] / С.Н. Тамкович, О.Е. Брызгунова, Е.Ю. Рыкова, Е.В. Колесникова, П.И. Шелестюк, П.П. Лактионов, В.В. Власов // Биомедицинская химия. – 2005. - Т. 51, №3. - С. 321-328.
  5. Kolesnikova E.V. Extracellular nucleic acids circulating in blood of patients with gastrointestinal cacer [Текст] / S. Tamkovich, E. Kolesnikova, O. Bryzgunova, E. Rykova, P. Shelestuk, V. Vlassov, P. Laktionov // 1st Russian - American conference “Biotechnology and oncology”. - St. Peterburg. – 2005. - P. 137-138.
  6. Колесникова Е.В. Уровень внеклеточных нуклеиновых кислот крови в диагностике опухолей желудочно-кишечного тракта [Текст] / Е.В. Колесникова, С.Н. Тамкович, О.Е. Брызгунова, П.И. Шелестюк, С.В. Пушкарев, Е.Ю. Рыкова, В.В. Власов, П.П. Лактионов // Новые технологии в онкологической практике. – Барнаул. – 2005. - С. 231.
  7. Kolesnikova E. Circulation of extracellular nucleic acids in blood of patients with gastrointestinal cancer [Текст] / S. Tamkovich, E. Kolesnikova, O. Bryzgunova, E. Rykova, P. Shelestuk, P. Laktionov, V. Vlassov // The International conference on chemical biology. – Novosibirsk. – 2005. - P.90.
  8. Kolesnikova E.V. Circulating DNA and DNase activity in human blood [Текст] / S.N. Tamkovich, A.V. Cherepanova, E.V. Kolesnikova, E.Y. Rykova, D.V. Pyshnyi, V.V. Vlassov, P.P. Laktionov // Ann. N. Y. Acad Sci. – 2006. - V.1075. - P. 191-196.
  9. Колесникова Е.В. Влияние дезоксирибонуклеазной активности на распределение внеклеточных нуклеиновых кислот в крови больных раком желудка и толстой кишки [Текст] / С.Н. Тамкович, А.В. Черепанова, Е.В. Колесникова, О.Е. Брызгунова, П.И. Шелестюк, Е.Ю. Рыкова, В.В. Власов, П.П. Лактионов // Конференция по фундаментальной онкологии «Петровские чтения-2006». - Санкт-Петербург. - 2006. - C. 37-38.
  10. Колесникова Е.В. Циркулирующая ДНК в крови больных раком желудка [Текст] / Е.В. Колесникова, С.Н. Тамкович, О.Е. Брызгунова. П.И. Шелестюк, С.А. Фурсов, Е.Ю. Рыкова, В.В. Власов, С.А. Тузиков, П.П. Лактионов // Региональная конференция молодых ученых- онкологов «Актуальные вопросы экспериментальный и клинической онкологии». – Томск. - 2006. - C 31-32.
  11. Колесникова Е.В. Концентрация внеклеточных ДНК и активность дезоксирибонуклеаз в плазме крови здоровых доноров и онкологических больных [Текст] / С.Н. Тамкович, А.В. Черепанова, О.Е. Брызгунова, Е.В. Колесникова, В.И. Пермякова, В.В. Власов, П.П. Лактионов // Материалы V конференции молодых ученых СО РАН, посвященной М.А. Лаврентьеву. – 2007. - Ч.2. - С. 55-58.
  12. Колесникова Е.В. Разработка неинвазивного метода диагностики рака желудка на основе анализа онкомаркеров во внеклеточной ДНК крови [Текст] / Е.В. Колесникова, П.И. Шелестюк, Е.Ю. Рыкова, В.В. Власов, С.А. Тузиков, П.П. Лактионов // II Региональная конференция молодых ученых им. академика РАМН Н.В. Васильева. „Актуальные вопросы экспериментальной и клинической онкологии”. – Томск. - 2007. - С.50.
  13. Kolesnikova E.V. Circulating DNA in blood of patients with gastric cancer [Текст] / E. Kolesnikova, P. Shelestuk, V. Vlassov, P. Laktionov, S. Tusikov, E. Rykova // 5 International conference on circulating nucleic acids in plasma/serum. – Moscow. - 2007. - P. 11.
  14. Колесникова Е.В. Исследование метилирования генов MGMT, p15, hMLH1 в циркулирующих ДНК крови больных раком желудка [Текст] / Е.В. Колесникова, С.Н. Тамкович, О.Е. Брызгунова, С.А. Тузиков, П.И. Шелестюк, В.И. Пермякова, В.В. Власов, П.П. Лактионов, Е.Ю. Рыкова // III Международная конференция «Фундаментальные науки - медицине». – Новосибирск. - 2007. - С. 130.
  15. Колесникова Е.В. Выявление ДНК маркеров в крови при раке желудка [Текст] / Е.В. Колесникова, С.Н. Тамкович, О.Е. Брызгунова // II Молодежный Медицинский Конгресс «Санкт-Петербургские научные чтения». - Санкт-Петербург. - 2007. – С. 98-99.
  16. Kolesnikova E.V. Circulating DNA in blood of patients with gastric cancer [Текст] / E.V. Kolesnikova, S.N. Tamkovich, O.E. Bryzgunova, P.I. Shelestuk, S.A. Tusikov, V.I. Permyakova, V.V. Vlassov, P.P. Laktionov, E.Y. Rykova // Ann N.Y. Acad Sci. – 2008. - V. 1137 - P. 226-232.
  17. Колесникова Е.В. Анализ онкомаркеров во внеклеточной ДНК крови [Текст] / Е.В. Колесникова, П.П. Лактионов, П.И. Шелестюк, С.А. Тузиков, В.В. Власов, Е.Ю. Рыкова // II Региональная конференция молодых ученых им. академика РАМН Н.В. Васильева. „Актуальные вопросы экспериментальной и клинической онкологии”. – Томск. – 2008. – С. 96-97.
  18. Колесникова Е.В. Исследование статуса метилирования генов MGMT, p15 и hMLH1 в циркулирующих ДНК крови при раке желудка [Текст] / Е.В. Колесникова, П.П. Лактионов, П.И. Шелестюк, С.А. Тузиков, В.В. Власов, Е.Ю. Рыкова // IV съезд Российского общества биохимиков и молекулярных биологов. – Новосибирск. - 2008. - С. 203.
  19. Колесникова Е.В. Циркулирующие ДНК крови в диагностике рака желудка [Текст] / Е.В. Колесникова, С.Н. Тамкович, О.Е. Брызгунова, В.И. Пермякова, П.И. Шелестюк, С.А. Тузиков, В.В. Власов, П.П. Лактионов, Е.Ю. Рыкова // Современные лечебные и диагностические методы в медицинской практике: Материалы 7-й научно-практической конференции врачей. - Новосибирск: ИТ СО РАН. – 2008. - С. 90.
  20. Колесникова Е.В. Активность дезоксирибонуклеаз и уровень циркулирующих ДНК в плазме крови здоровых доноров и больных раком желудка [Текст] / А.В. Черепанова, С.Н. Тамкович, Е.В. Колесникова, В.И. Пермякова, С.А. Тузиков, В.В. Власов, П.П. Лактионов // Современные лечебные и диагностические методы в медицинской практике: Материалы 7-й научно-практической конференции врачей.- Новосибирск: ИТ СО РАН. – 2008. - С. 277.

БЛАГОДАРНОСТИ

Автор выражает глубокую признательность П.И. Шелестюку, без которого данная работа не могла бы состояться.

СПИСОК СОКРАЩЕНИЙ:

РЖ – Рак желудка

цирДНК – циркулирующие

РЭА – раковый эмбриональный антиген

СА 19.9 – гликопротеин, представитель класса онкофетальных маркеров

СА 72.4 – гликопротеин, представитель класса онкофетальных маркеров

ВОЗ – Всемирная Организация Здравоохранения

М- медиана

Д- диапазон

AUC - численный показатель площади под кривой

АК - аденокарционома разной степени дифференцировки

Недифф. – недифференцированный рак

Перстн. – перстневидноклеточный тип рака

n – количество людей

Изд. лиц. ИД № 0460 от 20.02.2001

Подписано в печать 15.10.2008

Формат бумаги 60х84 1/16. Бумага №1.

Гарнитура “Times New Roman”.

Печать офсетная. Печ. л. 1.1. Уч.-изд.л. 1,0.

Тираж 100 экз., Заказ № 161.

Институт неорганической химии им. А.В. Николаева, СО РАН.

630090, г. Новосибирск, просп. Ак. Лаврентьева, 3.



 



<
 
2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.