WWW.DISUS.RU

БЕСПЛАТНАЯ НАУЧНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

Оптимальные тест-системы для количественного определения и детекции мутаций вируса гепатита в

На правах рукописи

Пичковская Виктория Анатольевна

Оптимальные тест-системы для количественного определения и детекции мутаций вируса гепатита В

03.00.04 «Биохимия»

Автореферат диссертации
на соискание ученой степени
кандидата медицинских наук

Москва-2004

Работа выполнена в Государственном некоммерческом учреждении «Гематологический научный центр Российской Академии медицинских наук».

Научный руководитель: кандидат биологических наук А.Б. Судариков
Официальные оппоненты: доктор медицинских наук, профессор Е.А. Лукина
доктор биологических наук, профессор М.И.Михайлов

Ведущая организация: Научно-исследовательский институт физико-химической медицины МЗ РФ.

Защита состоится « » 2004 г., в часов на заседании диссертационного совета Д 001.042.02 в Гематологическом научном центре РАМН (125167, г.Москва, Новозыковский пр-д, д. 4а).

С диссертацией можно ознакомиться в библиотеке Гематологического научного центра РАМН.

Автореферат разослан « » 2004 г.

Ученый секретарь диссертационного совета кандидат биологических наук В.Д. Реук

Общая характеристика работы.

Актуальность темы диссертации.

Вирусный гепатит В на протяжении нескольких десятилетий занимает одно из первых мест в инфекционной патологии человека. Поэтому возбудитель данного заболевания – ДНК-содержащий гепатотропный вирус гепатита В стал предметом пристального внимания и всестороннего изучения. В настоящее время показано, что в репликации данного вируса присутствует стадия обратной транскрипции РНК-прегенома. Обратная транскриптаза, осуществляющая этот процесс, лишена 3’5’ корректирующей функции, что определяет вариабельность вирусного генома. В сочетании с высокой репликативной активностью вируса гепатита В это приводит к повышению вероятности ошибки считывания РНК-матрицы и появлению мутантных штаммов. В свою очередь, мутации вирусного генома могут изменять профиль серологических маркеров, приводить к снижению эффективности стандартных схем противовирусной терапии и т.д. Отсюда возникла необходимость в комплексной диагностике вирусного гепатита В, включающей количественную оценку вируса в крови больного и анализ мутаций вирусного генома. С этой целью сегодня применяются различные методы генодиагностики, в частности метод полимеразной цепной реакции (ПЦР).

Наиболее распространенным методом количественной оценки вируса гепатита В является конкурентная ПЦР, основанная на коамплификации ДНК патогена и количественно охарактеризованного внутреннего стандарта. Создание подобного внутреннего стандарта составляет определенную сложность, что ограничивает применение количественных тест-систем, основанных на методе конкурентной ПЦР, в клинической диагностике.

В ПЦР-диагностике мутаций генома вируса гепатита В приоритетным направлением является детекция клинически значимых YMDD- и precore-мутаций, ассоциирующихся со снижением/отсутствием эффективности противовирусной терапии нуклеозидными аналогами или препаратами интерферона. Кроме того, precore-мутация определяет отсутствие основного маркера активной репликации вируса – HBe-антигена. YMDD- и precore- мутации вызваны однонуклеотидными заменами в ДНК вируса гепатита В. Поэтому для их выявления применяются методы, предназначенные для детекции SNPs (single nucleotide polymorphisms). В большинстве случаев с этой целью используют методы прямого секвенирования и определения длин рестрикционных фрагментов. Но данные методики обладают рядом недостатков: они технически сложны в исполнении и с их помощью довольно трудно оценить долю мутантных вирусных штаммов в общей вирусной популяции. Тем не менее, такая информация необходима для выработки эффективной тактики лечения больных вирусным гепатитом В.

Вышеизложенное определило цели и задачи данной работы.

Цель работы.

Создать оптимальные диагностические тест-системы для количественного определения и детекции мутаций вируса гепатита В.

Основные задачи исследования.

  1. Разработать методически простую технологию конструирования внутреннего стандарта для количественного определения ДНК патогенов методом конкурентной ПЦР на примере вируса гепатита В.
  2. Разработать диагностическую тест-систему для количественного определения ДНК вируса гепатита В методом конкурентной ПЦР, в которой будет использоваться полученный внутренний стандарт.
  3. Найти оптимальный метод для выявления дикого и YMDD/precore-мутантных штаммов вируса гепатита В, позволяющий оценивать долю мутантных штаммов в общей вирусной популяции.
  4. Апробировать разработанные тест-системы для количественного определения и детекции мутаций вируса гепатита В на сыворотках больных вирусным гепатитом В.

Научная новизна работы.

Впервые предлагается универсальный и методически простой способ конструирования внутреннего стандарта для одностадийной конкурентной ПЦР, позволяющей определять концентрацию ДНК патогенов. Доказывается, что метод аллель-специфической ПЦР для выявления мутаций в вирусном геноме применим в диапазоне концентраций ДНК от 104 до 107 геном/мл. Причем проведение аллель-специфической ПЦР в указанных концентрационных пределах позволяет оценивать долю мутантных штаммов в общей вирусной популяции.

Практическое значение работы.

Разработанная технология конструирования внутреннего стандарта для конкурентной ПЦР позволяет снизить себестоимость количественного ПЦР-анализа. Данная технология применена при создании тест-системы для определения концентрации ДНК вируса гепатита В в биологических жидкостях, основанной на методе конкурентной ПЦР. Предложенные в данной работе методики используются для оценки концентрации и выявления клинически значимых YMDD- и precore-мутаций ДНК в сыворотках больных вирусным гепатитом В, что позволяет контролировать эффективность проводимой противовирусной терапии.

Апробация работы.

Материалы диссертации доложены на конгрессе «Человек и лекарство» (2001 г, Москва), I Всероссийском съезде гематологов (2002 г, Москва), научно-практическом симпозиуме “Технологии генодиагностики в практическом здравоохранении”, проводимом в рамках международной научно-практической конференции “Геномика, протеомика и биоинформатика для медицины” (2002 г, Москва).

Публикации.

По материалам диссертации опубликовано 5 работ, в том числе получен патент на изобретение № 2194761, Государственный реестр изобретений РФ.

Объем и структура диссертации.

Диссертация изложена на 86 страницах, состоит из Введения, Обзора литературы, описания Материалов и методов, изложения Результатов и их Обсуждения, Выводов и Списка цитируемой литературы. Работа содержит 21 рисунок и 2 таблицы. Список цитируемой литературы включает 117 наименований. Работа выполнена на базе лаборатории молекулярной гематологии ГНЦ РАМН (зав. - к.б.н. Судариков А.Б.) За помощь и поддержку в проведении работы выражаем искреннюю благодарность в.н.с. лаборатории молекулярной гематологии ГНЦ РАМН к.б.н. Февралевой И.С., зав отд. патологии печени клиники нефрологии, внутренних и профессиональных заболеваний им. Е.М. Тареева д.м.н. проф. Крель П.Е., ст.н.с. ЦНИИ Эпидемиологии МЗ РФ к.б.н. Гущину А.В.

Материалы и методы исследования.

Сыворотки.

В исследовании использовали сыворотки больных вирусным гепатитом В, проходящих лечение в Гематологическом научном центре РАМН по поводу гемобластозов. Сыворотки, заведомо содержащие вирус гепатита В с YMDD-мутацией (по данным прямого определения нуклеотидной последовательности) были любезно предоставлены к.б.н. А.Е. Гущиным (ЦНИИ Эпидемиологии МЗ РФ).

Олигонуклеотиды.

Для выявления ДНК вируса гепатита В использовали 5’-CTTCGCTTCACCGCTGC-3’-прямой и 3’-CAGTTGCTGGCTGGAACTCCG-5’-обратный праймеры, фланкирующие участок 1458-1578 нуклеотидной последовательности (н.п.) ДНК вируса гепатита В.

Для выявления YMDD-мутации использовали праймеры, фланкирующие участок 720-998 н.п. ДНК вируса гепатита В. Причем прямые аллель-специфические праймеры (отличающиеся последним нуклеотидом на 3’-конце) ymdGs, ymdAs, ymdVs, ymdIs были подобраны к позиции 743 н.п. так, чтобы выявить возможные замены нуклеотидов в триплете ATG – локусе YMDD-мутации (т.е. выяляется триплет GTG в случае YVDD-варианта мутации и триплет ATT в случае YIDD-варианта мутации):

ymdGs: 5’-TGACAAACCGAAAGTCAATATAC-3’ -выявляют: YMDD-вариант (дикий штамм)
ymdAs: 5’-TGACAAACCGAAAGTCAATAT-3’
ymdVs: 5’-TGACAAACCGAAAGTCAATAC-3’ - YVDD-вариант (штамм с мутацией)
ymdIs: 5’-TGACAAACCGAAAGTCAATATAA-3’ - YIDD-вариант (штамм с мутацией)

Общий обратный праймер ymdCOMas - 5’GATTGGAAAGTATGTCAACG3’

Для выявления precore-мутации использовались праймеры, фланкирующие участок 1880-2084 н.п. ДНК вируса гепатита В. Прямые аллель-специфические праймеры precWCs и precMTs были подобраны к позиции 1896 н.п. так, чтобы выявить возможные замены нуклеотидов в триплете ТТG – локусе precore-мутации G1896A:

precWCs 5’-ACGGAACCCACCGAAAC-3’ -выявляет дикий штамм
precMTs 5’-ACGGAACCCACCGAAAT-3’ -штамм с мутацией G1896A

Общий обратный праймер precCOMas 5’-GCAAAGAATTGCTTGCCTGA-3’.

Все представленные выше праймеры были синтезированы фирмой «Синтол», Россия.

Подготовка образцов сывороток.

Исследуемую сыворотку разводили в соотношении 1:1 в буфере для выделения ДНК (изотонический раствор NaCl, содержащий 0,05% NP40 и 20% DMSO). Смесь прогревали в течение 10 минут при 950 С, центрифугировали, супернатант отбирали и использовали в полимеразной цепной реакции.

Полимеразная цепная реакция (ПЦР).

Для выявления ДНК вируса гепатита В готовили реакционную смесь объемом 25 мкл следующего состава: 5 мкл полученного супернатанта; по 0,1 пмоль прямого и обратного праймера (фланкирующих участок 1458-1578 н.п. ДНК вируса гепатита В); смесь для ПЦР (10 мM Tris-HCl, pH 8.3, 50 мM KСl, 2,5 мM MgCl2, 4% формамид, дезоксирибонуклеотидтрифосфаты по 0,2 мМ каждого («Бион», Россия), 1 единица Taq-ДНК полимеразы («Синтол», Россия); деионизованная вода). Для получения внутреннего стандарта в качестве матрицы использовали 100 нг ДНК, выделенной из мононуклеарных клеток человека. Реакцию амплификации проводили в программируемом термостате Perkin-Elmer Cetus. Температурный режим ПЦР:

для выявления ДНК вируса гепатита В: 35 циклов при 94°С – 15 сек., 56°С – 15 сек., 72°С – 15 сек. с последующим инкубированием при 72°С в течение 10 мин.;

для получения внутреннего стандарта: 5 циклов при 94°С – 15 сек., 37°С – 15 сек., 72°С – 15 сек., затем 30 циклов при 94°С – 15 сек., 56°С – 15 сек., 72°С – 15 сек. с последующим инкубированием при 72°С в течение 10 мин.

При выявлении YMDD и precore-мутаций для каждого исследуемого образца готовили 6 реакционных проб объемом 25 мкл каждая, содержащие по 5 мкл супернатанта; 1 мкМ одного из аллель-специфических праймеров; по 1 мкМ обратных праймеров и смесь для ПЦР (см. выше). Реакцию амплификации проводили в программируемом термостате Perkin-Elmer Cetus в следующих условиях: 35 циклов при 94°С – 15 сек., 54°С – 15 сек., 72°С – 15 сек. с последующим инкубированием при 72°С в течение 10 мин.

Продукты реакции анализировали методом электрофореза в 2% агарозном геле.

Клонирование внутреннего стандарта.

Выбранный в качестве внутреннего стандарта для конкурентной ПЦР, выявляющей ДНК вируса гепатита В, амплификационный ДНК-фрагмент был лигирован в плазмидный вектор pGem-T Easy (Promega) и клонирован в клетках E. coli (штамм ТВ1). Селекция клонов с лигированным фрагментом проводилась на среде LB + 2% агар + x-GAL + IPTG + ампициллин (в вектор встроен ген устойчивости к ампициллину). Белые колонии проверяли на наличие вставки методом ПЦР. Секвенирование полученной плазмидной ДНК проводилось в институте молекулярной биологии им. Энгельгарта. Все манипуляции по очистке ДНК-амплификата, его лигированию в плазмидный вектор, клонированию и выделению плазмидной ДНК со вставкой осуществляли по стандартным методикам, описанным в Current Protocols in Molecular Biology (on CD) и инструкции, прилагаемой к коммерческому набору «pGem®-T Easy Vector. System 1» (Promega).

Концентрация плазмидной ДНК с внутренним стандартом определялась спектрофотометрическим методом.

Конкурентная ПЦР.

Для количественного определения ДНК вируса гепатита В брали сыворотку крови положительную по ДНК данного вируса в качественном ПЦР-анализе (см. п. «ПЦР для выявления ДНК вируса гепатита В»). Готовили серию десятикратных разведений вектора, содержащего внутренний стандарт в концентрации от 103 до 1010 геном/мл, в буфере для выделения ДНК. Пробы для количественного ПЦР были приготовлены по следующему протоколу: к 2,5 мкл сыворотки добаляли по 2,5 мкл каждого из соответствующих приготовленных разведений. Затем пробы прогревали при 95°С в течение 10 мин, после чего в каждую добавляли по 20 мкл смеси для ПЦР и праймеры, фланкирующие участок 1458-1578 н.п. ДНК вируса гепатита В, и проводили амплификацию (см. п. «ПЦР для выявления ДНК вируса гепатита В»). Продукты реакции анализировали методом электрофореза в 2% агарозном геле.

Содержание работы.

Обзор информации о методах генодиагностики вирусного гепатита В показал, что в настоящее время существует необходимость в создании методически простых диагностических тест-систем для количественной оценки и идентификации клинически значимых мутаций ДНК вируса гепатита В, с помощью которых можно контролировать эффективность проводимой противовирусной терапии и корректировать тактику лечения в случае выявления мутантных штаммов вируса.

Большинство существующих методов количественной оценки вируса в крови или сыворотке реализуют принцип конкурентной ПЦР, основанной на коамплификации выявляемой ДНК и внутреннего стандарта. Внутренний стандарт представляет собой фрагмент ДНК, имеющий длину, отличную от длины выбранного для амплификации участка выявляемой ДНК, но общие с ним районы, связывающие праймеры в ПЦР. Такой внутренний стандарт в ПЦР выполняет две основные функции. Во-первых, позволяет избегать получения ложноотрицательных результатов реакции. Во-вторых, позволяет определять концентрацию выявляемой ДНК, т.к. при внесении в пробу он конкурирует с выявляемой ДНК за связывание с праймерами и амплификацию, и равные количества ПЦР-продуктов амплифицируются в том случае, если начальные концентрации выявляемой ДНК и внутреннего стандарта равны. Поскольку в пробу вносится известное количество внутреннего стандарта, то можно оценить количество выявляемой ДНК.

Одна из задач, поставленных нами в данной работе, состояла в том, чтобы разработать наименее трудоемкую технологию конструирования внутреннего стандарта для конкурентной ПЦР. В ходе ее решения руководствовались тем, что при температуре, существенно меньшей, чем оптимальная температура отжига праймеров в ПЦР, специфичность взаимодействия "праймер-матрица" снижается. В этих условиях в ПЦР с произвольной ДНК и праймерами к определенному участку выявляемой ДНК нарабатывается множество неспецифических амплификационных фрагментов, т.к. для инициации процесса ДНК-полимеризации достаточно комплементарности нескольких оснований в последовательности ДНК-матрицы и нескольких нуклеотидов, прилегающих к 3’-концу используемых праймеров. Далее в ходе реакции при оптимальной температуре отжига праймеров нарабатываются ДНК-фрагменты, имеющие последовательности, комплементарные использованным праймерам и, следовательно, коамплифицирующиеся с выявляемой ДНК. Следует отметить, что данная методика применима для получения внутреннего стандарта только для одностадийной ПЦР, когда не требуется наличия специфических участков внутри амплификационного фрагмента, использующегося в качестве внутреннего стандарта. Предложенная нами технология запатентована в Российском агенстве по патентам и товарным знакам (патент на изобретение № 2194761, Государственный реестр изобретений РФ).

Методику, представленную выше, применили при создании внутреннего стандарта, амплифицирующегося с праймерами для выявления ДНК вируса гепатита В. В качестве исходной матрицы была взята ДНК, выделенная из мононуклеарных клеток человека. Матрицу проамплифицировали с праймерами, фланкирующими один из участков нуклеотидной последовательности ДНК вируса гепатита В. Причем условия амплификации были следующими: в первых 5 циклах реакции температура отжига была на 19°С ниже температуры, оптимальной для данной пары праймеров, а в последующих 30 циклах отжиг осуществлялся при оптимальной температуре (см. п. «ПЦР для получения внутреннего стандарта»). В результате получили смесь фрагментов ДНК различной длины, имеющих фланкирующие последовательности, комплементарные праймерам, выявляющим ДНК вируса гепатита В, каждый из которых может служить внутренним стандартом в конкурентной ПЦР для выявления данного патогена (Рис. 1).


Рис. 1. Внутренний стандарт для конкурентной ПЦР, выявляющей ДНК вируса гепатита В.

Дорожки: 1 – амплификация ДНК мононуклеаров с праймерами, выявляющими ДНК вируса гепатита В; 2 – отрицательный контроль (амплификация без ДНК мононуклеарных клеток и вируса гепатита В); 3 – амплификация ДНК вируса гепатита В; 4 – маркер молекулярного веса (1kb Ladder, Promega).

Далее выбрали фрагмент длиной 500 п.н., последовательность которого определили прямым секвенированием. Последовательность фрагмента представлена на Рис. 2.

Рис. 2. Нуклеотидная последовательность фрагмента ДНК, выбранного в качестве внутреннего стандарта.

Заглавными буквами обозначены участки связывания с праймерами, выявляющими ДНК вируса гепатита В.

В базе данных GenBank провели сравнительный анализ полученной последовательности, в ходе которого было установлено, что это участок ДНК E.coli с фланкирующими последовательностями, комплементарными соответствующим праймерам для выявления ДНК вируса гепатита В. Причина того, что данный фрагмент является участком ДНК E.coli, а не принадлежит участку ДНК, использовавшейся в качестве матрицы в ПЦР, возможно, объясняется следующим образом. В реакции амплификации использовался препарат рекомбинантой ДНК-полимеразы Taq, при получении которого применялись клетки E.coli, трансформированные плазмидным вектором, в состав которого был введен ген ДНК-полимеразы Taq. Поэтому в растворе мог содержаться геномный материал клеток-продуцентов данного фермента, т.е. ДНК клеток E.coli. Однако, как видно на электрофореграмме, представленной на Рис. 1, при сравнении ПЦР-продуктов на дорожках 1 и 2, кроме фрагментов, принадлежащих ДНК E.coli, в смеси все же присутствуют фрагменты ДНК мононуклеарных клеток. Отсюда следует, что при получении внутреннего стандарта для конкурентной ПЦР предложенным нами методом можно использовать несколько ДНК-матриц.

После определения нуклеотидной последовательности фрагмента ДНК, выбранного в качестве внутреннего стандарта, и обнаружения в его составе участков, комплементарных праймерам для выявления ДНК вируса гепатита В, для получения необходимого количества внутреннего стандарта данный фрагмент лигировали в плазмиду и клонировали в клетках E. coli. Соответствующая плазмида выделена из E. coli, очищена и растворена в воде, и после подсчета количества копий плазмидной ДНК в миллилитре водного раствора такой раствор использовался в качестве внутреннего стандарта для конкурентной ПЦР, выявляющей ДНК вируса гепатита В. Эффективность коамплификации внутреннего стандарта и ДНК вируса гепатита В проверялась в конкурентной ПЦР с плазмидной ДНК, содержащей участок 1458-1578 н.п. ДНК вируса гепатита В. Результаты опыта представлены на Рис. 3.

Рис. 3. Эффективность коамплификации внутреннего стандарта и ДНК вируса гепатита В.

Дорожки: 1-5 – плазмидная ДНК, содержащая участок 1458-1578 н.п. ДНК вируса гепатита В (106 (а) и 107 (б) геном/мл), 120 п.н. + внутренний стандарт (108104 геном/мл), 500 п.н.

После определения эффективности коамплификации внутренний стандарт использовался в конкурентной ПЦР для количественного определения ДНК вируса гепатита В в сыворотке крови. Для этого готовили последовательные разведения раствора, содержащего внутренний стандарт в известной концентрации, в которые добавляли один и тот же объем исследуемой сыворотки крови. С этой смесью проводили ПЦР. В реакции, согласно принципу конкурентной ПЦР, равные количества продуктов должны были амплифицироваться в том случае, если начальные концентрации внутреннего стандарта и выявляемой ДНК равны. Поэтому при визуализации ПЦР-продуктов в агарозном геле выявляли пробу, в которой ампликон, соответствующий внутреннему стандарту в определенной концентрации, и ампликон, соответствующий ДНК вируса гепатита В, имеют сопоставимую интенсивность флуоресценции в УФ-лучах. Так в случае, показанном на Рис. 4, концентрация ДНК вируса гепатита В составила 108 геном-эквивалент/мл.

Рис. 4. Определение количества ДНК вируса гепатита В в конкурентной ПЦР.

Дорожки: 1 – сыворотка, содержащая ДНК вируса гепатита В, 120 п.н.; 2 - 6 - сыворотка с ДНК вируса гепатита В, 120 п.н. + внутренний стандарт (109105 геном/мл), 500 п.н.; 7 - маркер молекулярного веса (1kb Ladder, Promega).

Таким образом, на базе полученного внутреннего стандарта создали in house тест-систему для количественного определения ДНК вируса гепатита В в биологических жидкостях.

Кроме количественного определения ДНК вируса гепатита В, как уже упоминалось ранее, в ходе лечения возникает необходимость выявления мутационных изменений в вирусном геноме, в частности выявления клинически значимых YMDD- и precore- мутаций. Эти мутации вызваны однонуклеотидными заменами в ДНК вируса гепатита В, поэтому для их выявления применяются методы, предназначенные для детекции SNPs (single nucleotide polymorphisms). Анализ литературных данных показал, что кроме прямого секвенирования и определения длин рестрикционных фрагментов для детекции однонуклеотидных замен можно использовать более простой метод аллель-специфической ПЦР.

Принцип данного метода состоит в том, что в ПЦР фермент ДНК-полимераза Taq осуществляет процесс элонгации ДНК только в случае строгой комплементарности 3’-конца праймера соответствующему участку ДНК-матрицы. Таким образом, замена нуклеотида в ДНК-матрице может быть обнаружена по отсутствию амплификации с праймером, 3’-конец которого приходится точно на место мутации. Однако амплификация может быть осуществлена с измененным праймером, 3’-конец которого комплементарен мутантному нуклеотиду.

Исходя из этого были подобраны праймеры, способные выявлять дикий тип вируса и все возможные замены нуклеотидов ДНК вируса гепатита В в случае YMDD-мутации и precore-мутации G1896А (см. п. «Олигонуклеотиды»). С праймерами и ДНК вируса гепатита В проводили аллель-специфическую ПЦР, результаты которой представлены на Рис. 5 и Рис. 6. В данном опыте использовались сыворотки, заведомо содержащие вирус гепатита В с YMDD- и precore-мутацией (по данным прямого определения нуклеотидной последовательности).


Рис. 5. Результаты аллель-специфической ПЦР по выявлению дикого и YMDD-мутантных штаммов вируса гепатита В.

Длина амплификата 278 п.н.

Дорожки: 1-4 - результат амплификации с аллель- - специфическими праймерами ymdGs, ymdAs, ymdVs, ymdIs,соответственно; 5 – маркер молекулярного веса (500; 278 и 120 п.н.)

Так, на электрофореграмме, представленной на Рис. 5, видно, что в случае а) при использовании всех четырех пар праймеров ПЦР-продукты образуются только в образцах, содержащих ymdAs и ymdGs, которые выявляют дикий тип вируса, в то время как в случае б) срабатывают праймеры ymdAs и ymdIs, выявляющие мутантный штамм вируса (YIDD-вариант).

Рис. 6. Результаты аллель-специфической ПЦР по выявлению дикого и precore-мутантных штаммов вируса гепатита В.

Длина амплификата 204 п.н.

Дорожки: 1, 2 – Результат амплификации с аллель- - специфическими precWCs и precMTs праймерами,соответственно; 5 – маркер молекулярного веса.

На электрофореграмме Рис. 6 видно, что в случае а) ПЦР-продукты регистрируются в образце, содержащем precWCs-праймер, выявляющий дикий штамм вируса, а в случае б) – регистрируются в образце, где присутствует праймер precMTs, выявляющий мутантный штамм вируса G1896A.

В ходе экспериментов по выявлению YMDD- и precore-мутантных штаммов вируса гепатита В методом аллель-специфической ПЦР было установлено, что для получения адекватных результатов, концентрация вируса в исследуемом образце не должна превышать 107 геном/мл. Если концентрация вируса в сыворотке превышает 107 геном/мл, то при проведении ПЦР с аллель-специфическими праймерами образуются ПЦР-продукты, соответствующие как дикому, так и всем мутантным штаммам вируса (Рис. 7 б). При разведении таких сывороток до концентрации 107 геном/мл и менее определяли в этих образцах наличие только дикого или сочетание дикого и одной из мутантных форм вируса (Рис. 7 а).

Рис. 7. Результаты аллель-специфической ПЦР по выявлению дикого и YMDD-мутантных штаммов вируса гепатита В в сыворотках с разной концентрацией ДНК.

а) – концентрация ДНК вируса гепатита В 107 геном-эквивалент/мл; б) – концентрация ДНК вируса гепатита В 109 геном-эквивалент/мл.

Длина амплификата 278 п.н.

Дорожки: 1-4 - результат амплификации с аллель- - специфическими праймерами ymdGs, ymdAs, ymdVs, ymdIs,соответственно.

Данная ситуация может быть вызвана появлением неспецифических ПЦР-продуктов в реакции с высокой концентрацией ДНК-матрицы. Так, в работах, посвященных исследованию кинетических характеристик аллель-специфической ПЦР, было показано, что в реакции амплификации возможно связывание аллель-специфических праймеров с некомплементарным нуклеотидом матрицы (например G:A, A:A, T:T и т.д.) и элонгация цепей ДНК. Однако количество ПЦР-продуктов в этом случае будет значительно меньше, чем при связывании праймеров с комплементарным нуклеотидом матрицы. Отсюда следует, что при увеличении концентрации ДНК-матрицы соответственно возрастет количество ПЦР-продуктов, образующихся при правильном и ошибочном отжиге аллель-специфических праймеров. Поэтому для установления концентрационных пределов для матрицы в аллель-специфической ПЦР был проведен следующий эксперимент. В сыворотку, не содержащую ДНК вируса гепатита В, добавляли амплификационный фрагмент, полученный в ПЦР с ymdMs-праймером и ДНК дикого штамма вируса (имеющий в своем составе последовательность ATG, что соответствует дикому штамму вируса) в концентрации от 103 до 109 копий ДНК. Затем с сывороткой, содержащей амплификационный фрагмент в соответствующей концентрации, и аллель-специфическими праймерами ymdAs, ymdGs, ymdIs и ymdVs, проводили ПЦР. Результаты представлены на Рис. 8.

Рис. 8 Определение пределов чувствительности аллель-специфической ПЦР для выявления дикого и мутантных штаммов вируса.

Длина амплификата 278 п.н.

Дорожки: 1 – маркер молекулярного веса (500/278; 200; 134 п.н); 2 – 5 – результат амплификации с аллель- - специфическими праймерами ymdGs, ymdAs, ymdVs, ymdIs,соответственно.

Поскольку в качестве матрицы в ПЦР использовался амплификационный фрагмент, соответствующий дикому штамму вируса, то продукты аллель-специфической ПЦР должны были регистрироваться только в пробах, где присутствовали праймеры ymdAs и ymdGs, выявляющие данный штамм.

Однако, как видно на электрофореграммах, представленных на Рис. 8, если начальная концентрация ДНК была больше 107 копий, то регистрировались ПЦР-продукты в пробах, где присутствовали праймеры, выявляющие как дикий, так и мутантный штамм вируса. Таким образом, было показано, что предельная концентрация ДНК вируса в аллель-специфической ПЦР - 107 копий. На электрофореграммах также видно, что ПЦР-продукты регистрируются в пробах, где начальная концентрация ДНК составляла от 104 копий, следовательно, нижний предел чувствительности метода – 104 копий ДНК.

Так было доказано, что в случае сыворотки с высокой вирусной нагрузкой (более 107 геном/мл) обнаружение ПЦР-продуктов, соответствующих наличию вирусов всех форм, связано с появлением неспецифических ПЦР-продуктов.

Но существует еще одна причина такой ситуации. По данным литературы известно, что мутантные штаммы вируса в минорных количествах почти всегда присутствуют в вирусной популяции. Значит проведение аллель-специфической ПЦР с образцами, концентрация ДНК вируса в которых более 107 геном/мл, может выявлять эти штаммы в количестве 0,1 % и менее от общей вирусной популяции. Отсюда следует, что разведение сыворотки до концентрации вирусной ДНК 107 геном/мл и менее позволяет отсечь вклад минорных количеств мутантных штаммов и неспецифических реакций. Так, если в нативной сыворотке концентрация мутантных штаммов вируса составляет 0,1% и менее относительно дикого штамма, то при ее разведении до указанной концентрации после проведения ПЦР не будет зарегистрировано наличия ПЦР-продуктов, соответствующих мутантным штаммам, т.к. их количество находится за пределами чувствительности метода. В этом случае можем говорить о том, что в крови больного преимущественно содержится вирус дикого типа. Если же при разведении в образце ДНК до концентрации 107 геном/мл после ПЦР регистрируются оба (дикий и мутантный) штаммы вируса, то в исследуемом образце концентрация вирусов, несущих YMDD- или precore-мутацию была не менее 104 геном/мл, следовательно, концентрации дикого и мутантного штаммов в такой сыворотке различаются не более, чем в 1000 раз, и в крови одновременно присутствуют две формы вируса. Наличие ПЦР-продуктов, соответствующих только мутантным штаммам вируса свидетельствует о том, что в крови больного количество вируса с мутацией на три порядка превышает немутантную форму. Таким образом, было установлено, что методом аллель-специфической ПЦР можно определять соотношение мутантного и дикого штаммов в сыворотке крови.

Следует отметить, что метод аллель-специфической ПЦР ранее не применялся для оценки доли мутантных штаммов в общей вирусной популяции. Между тем нами установлено, что проведение аллель-специфической ПЦР в концентрационных пределах от 104 до 107 геном/мл поможет ответить на вопрос, с каким штаммом, диким или мутантным, на данном этапе заболевания связан процесс повреждения печени, а это, в свою очередь, немаловажно для выбора оптимальной тактики лечения.

Представленные выше методики в дальнейшем использовались для оценки концентрации и выявления клинически значимых YMDD- и precore-мутаций ДНК вируса в сыворотках больных вирусным гепатитом В с патологией системы крови. В ходе работы был создан банк сывороток, в который вошли 32 HBsAg-положительные и содержащие ДНК вируса гепатита В сыворотки больных, получающих химиотерапию при лечении гемобластозов. При исследовании данных сывороток использовали следующий алгоритм. Вначале методом конкурентной ПЦР определяли концентрацию вирусной ДНК. Если концентрация ДНК в сыворотках превышала 107 геном-эквивалент/мл, то перед постановкой аллель-специфической ПЦР их разводили до указанной концентрации. Затем проводили аллель-специфическую ПЦР для выявления YMDD- и precore G1896A - мутантных штаммов вируса гепатита В. В результате было показано, что концентрация ДНК вируса гепатита В в этих сыворотках составила от 107 до 1010 геном-эквивалент/мл, при разведении сывороток до концентрации ДНК 107 геном-эквивалент/мл и менее регистрировались ПЦР-продукты, соответствующие только диким штаммам вируса.

Заключение.

В ходе данного исследования был разработан методически простой способ конструирования внутреннего стандарта для одностадийной конкурентной ПЦР. Предложенная нами технология получения внутреннего стандарта запатентована в Российском агенстве по патентам и товарным знакам (патент на изобретение № 2194761, Государственный реестр изобретений РФ). Она была применена при создании диагностической тест-системы, основанной на методе конкурентной ПЦР, для количественного определения ДНК вируса гепатита В в биологических жидкостях. Для выявления клинически значимых мутаций в ДНК вируса гепатита В использовали аллель-специфическую ПЦР. Было установлено, что данная методика применима в диапазоне концентраций ДНК от 104 до 107 геном/мл. Причем проведение аллель-специфической ПЦР в указанных концентрационных пределах позволяет оценивать долю мутантных штаммов в общей вирусной популяции. Обе методики (конкурентную и аллель-специфическую ПЦР) применили для оценки концентрации и выявления YMDD- и precore-мутантных штаммов вируса гепатита В в HBsAg-положительных и содержащих ДНК вируса сыворотках больных, проходящих лечение в Гематологическом научном центре РАМН по поводу гемобластозов. В результате в сыворотках этих больных выявили содержание ДНК вируса гепатита В в концентрации от 107 до 1010 геном-эквивалент/мл с превалированием дикого штамма.

Таким образом, в данной работе предлагается ряд методик, которые могут использоваться в клинической диагностике с целью контроля эффективности терапии вирусного гепатита В и коррекции протокола лечения в случае выявления мутаций в геноме вируса.


Выводы

  1. Разработана и запатентована новая технология создания внутреннего стандарта для количественного определения ДНК патогенов методом конкурентной ПЦР.
  2. Разработана диагностическая тест-система для количественного определения ДНК вируса гепатита В методом конкурентной ПЦР.
  3. Показано, что аллель-специфическая ПЦР для выявления вирусных мутаций применима в диапазоне концентраций от 104 до 107 геном-эквивалент/мл.
  4. Установлено, что с помощью аллель-специфической ПЦР можно оценить долю мутантных штаммов в общей популяции вируса гепатита В.
  5. Разработанные тест-системы для количественного определения и детекции мутаций вируса гепатита В апробированы на сыворотках больных вирусным гепатитом В.

Список публикаций по теме диссертации.

    1. Пичковская В.А. Февралева И.С., Судариков А.Б. Разработка тест-системы, основанной на методе полимеразной цепной реакции, для количественного определения ДНК вируса гепатита В в сыворотке крови. // Вестник РГМУ. - 2001. - № 2 (17). - С. 153.
    2. Пичковская В.А., Февралева И.С., Ибрагимова М.М., Соловьева Т.И., Крель П.Е., Судариков А.Б. Детекция YMDD-мутации в ДНК вируса гепатита В с помощью аллель-специфической полимеразной цепной реакции // Молекулярная генетика, вирусология и микробиология. – 2004. – № 1. – С. 27-29.
    3. Февралева И.С., Пичковская В.А., Судариков А.Б.. Новая технология конструирования внутреннего стандарта для количественной полимеразной цепной реакции. // Проблемы гематологии и переливания крови. – 2002. - № 1. - С. 89.
    4. Февралева И.С., Пичковская В.А., Судариков А.Б. Разработка экспресс-диагностикума для количественного определения ДНК гепатита В в сыворотке крови. Тез. докл. Научно-практический симпозиум "Технологии генодиагностики в практическом здравоохранении". М.: НПО «Литех», 2002 г. – С. 31-33.
    5. Февралева И.С., Пичковская В.А., Судариков А.Б. Способ конструирования внутреннего стандарта для количественного определения ДНК патогенов методом конкурентной полимеразной цепной реакции. Патент на изобретение № 2194761. М.: Государственный реестр изобретений РФ, 2002.


 



<
 
2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.