WWW.DISUS.RU

БЕСПЛАТНАЯ НАУЧНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

Мобильные генетические элементы bordetella pertussis и их роль в регуляции генов вирулентности возбудителя коклюша. 03. 00.07 - микробиология

На правах рукописи

Каратаев

Геннадий Иванович

Мобильные генетические элементы Bordetella pertussis и их роль в регуляции генов вирулентности возбудителя коклюша.

03. 00.07 - микробиология

03.00.15 - генетика

Автореферат

диссертации на соискание ученой степени

доктора биологических наук

Москва 2008

Работа выполнена в Государственном учреждении научно-исследовательском институте эпидемиологии и микробиологии имени почетного академика Н.Ф. Гамалеи Российской академии медицинских наук.

Научный консультант:

член-корреспондент РАМН,

доктор биологических наук,

профессор Смирнов Георгий Борисович

Официальные оппоненты:

Доктор биологических наук, Миронов Александр Сергеевич

профессор

Доктор медицинских наук Мазурова Изабелла Константиновна

Доктор медицинских наук Шагинян Игорь Андроникович

Ведущая организация: ГОУ ВПО Российский государственный медицинский университет Росздрава

Защита диссертации состоится 2008 г. в 11 часов на заседании диссертационного совета Д 001.007.01 в ГУ научно-исследовательском институте эпидемиологии и микробиологии им. Н.Ф. Гамалеи РАМН (123098 г. Москва ул. Гамалеи д.18).

С диссертацией можно ознакомиться в библиотеке ГУ НИИЭМ им. Н.Ф. Гамалеи РАМН.

Ученый секретарь диссертационного

совета, доктор медицинских наук,

профессор Русакова Е.В.

Общая характеристика работы.

Актуальность проблемы.

Коклюш – респираторное заболевание людей, вызываемое грам-отрицательными бактериями Bordetella pertussis. Бактерии B.pertussis передаются от человека к человеку воздушно-капельным путем. Профилактика коклюша входит в национальный календарь плановых прививок и обеспечивается программами массовой вакцинации детей. Несмотря на это, циркуляция возбудителя коклюша в популяции не уменьшается. Ежегодно в мире регистрируется до 48,5 миллионов заболеваний, из них до 300 000 случаев заканчиваются летальным исходом (Crowcroft N.S. et al. 2003). Чаще, и в более тяжелой форме, коклюшем болеют дети первого года жизни, но в последнее время отмечается рост числа лабораторно подтвержденных случаев коклюша у подростков и взрослых (Cherry JD, Heininger U, 2004). Эпидемиологические исследования показали, что последние являются основным резервуаром инфекции для заражения наиболее восприимчивых к заболеванию новорожденных (Mattoo S,Cherry JD, 2005). Отмечены случаи бессимптомного носительства B.pertussis (Heininger UW et al., 2004). Активно изучаются механизмы носительства и персистенции возбудителя в организме человека. Установлена связь между переживанием бактерий Bordetella внутри эукариотической клетки и экспрессией некоторых факторов вирулентности возбудителя (Bassinet L, 2000).

Одной из характерных особенностей возбудителя коклюша является высокая степень изменчивости его фенотипических признаков. Бактерии с разной вирулентностью, формой колоний и способностью к гемолизу эритроцитов были выделены на разных стадиях заболевания, при экспериментальном заражении лабораторных животных и при культивировании in vitro (обзор Wardlaw A, Parton R, 1988). Такие бактерии были названы фазовыми вариантами (Lacey B. 1960), а их переход из одной фазы в другую – фазовым переходом.

На протяжении последних 20-и лет проведены многочисленные молекулярно-генетические исследования структуры и экспрессии генов вирулентности. Установлено, что большинство из них регулируется на уровне транскрипции, управляемой двухкомпонентной сенсорной системой BvgAS Bordetellа (Cotter PA, Miller JF, 2001, Cummings CA et al., 2006).

Регуляция экспрессии генов вирулентности Bordetellа изучена главным образом в экспериментах in vitro. Только в одной работе предпринята попытка анализа транскрипции bvgAS-зависимых генов cya, fha, prn и ptx в процессе размножения бактерий в легких мышей после их аэрозольного заражении вирулентным штаммом B.pertussis (Wendy L, Stibitz S, 2005). Отсутствие адекватной модели затрудняет изучение роли отдельных факторов вирулентности и фазовых переходов в формировании и развитии инфекционного процесса в экспериментах на животных. Остается открытым вопрос о механизме формирования носительства (персистенции) возбудителя коклюша в организме человека (Mattoo S, Cherry JD, 2005, Cummings CA et al., 2006).

Установлена структурная организация и последовательности хромосом B.pertussis, B.parapertussis и B.bronchiseptica, что позволило идентифицировать повторяющиеся IS–подобные элементы и геномы профагов в хромосомах микроорганизмов рода Bordetella (McLafferty MA et.al.,1989, McPheat WL et.al., 1989, Parkhill JM et al., 2003). Использование современных методов молекулярного анализа (пульс-электрофореза и IS-типирования и гибридизации) выявило значительные отличия структуры хромосом бактерий B.pertussis, выделенных в разные периоды времени и в различных географических регионах (Mary M et al., 2006). Изменения структуры хромосомы обнаружены и после пассажа бактерий B.pertussis на питательных средах in vitro (Brinig MM et al., 2006). Авторы полагают, что перестройки являются следствием рекомбинаций, индуцированных IS-подобными элементами B.pertussis. События гомологичной и «незаконной рекомбинации», индуцированные IS-элементами, обеспечили редуктивную эволюцию геномов микроорганизмов рода Bordetella (Cummings CA et al., 2004, Mary M et al., 2006). Высказываются предположения о формировании некоторых фазовых вариантов B.pertussis в результате перемещения (исключения) IS-элементов в оперон bvgAS B.pertussis (Stibitz S et al., 1989, Monack DM et al., 1989, McGillivray DM al., 1989). Однако экспериментально эти предположения не были подтверждены.

Актуальность проведенных исследований определяется необходимостью расширения знаний об эпидемиологически значимом возбудителе инфекционного заболевания человека. Идентификация мобильных генетических элементов B.pertussis (IS-элементов, Tn-подобных структур, бактериофагов), определение факторов, влияющих на частоту перемещения МГЭ в клетках B.pertussis, изучение роли МГЭ в регуляции вирулентности возбудителя коклюша, позволит понять механизмы изменчивости и адаптации бактерий возбудителя коклюша к среде обитания.

Используемые в настоящее время бактериологические методы лабораторной диагностики коклюша недостаточно чувствительны, а серологические методы недостаточно специфичны. Идентификация ДНК B.pertussis с помощью методов полимеразной цепной реакции (ПЦР) (Xuan Qin et al., 2007) не нашла широкого применения в отечественной практике здравоохранения (И.Н. Лыткина и др., 2004). Необходимость дальнейшего совершенствования лабораторной диагностики возбудителя коклюша, в том числе, методов анализа фазовых вариантов бактерий B.pertussis in vitro и in vivо, определяет актуальность прикладного раздела исследования. Тест-системы для обнаружения ДНК возбудителя коклюша в клиническом материале с помощью ПЦР и методы выявления бактерий B.pertussis, содержащих инсерцию IS–элемента в генах вирулентности, будут использованы для изучения носительства возбудителя коклюша, диагностики атипичных форм заболевания, определения структуры и механизмов формирования резервуаров инфекции.

Цель исследования Выявление генетических основ и молекулярных механизмов изменчивости B.pertussis и роли мобильных генетических элементов (МГЭ) в регуляции экспрессии генов вирулентности возбудителя коклюша.

Задачи исследования:

1. Выделение и характеристика повторяющейся последовательности (RS) и Tn – подобных элементов хромосомы B.pertussis.

2. Разработка экспериментального метода для регистрации событий перемещения RS–элементов в специфические сайты хромосомы B.pertussis. Определение факторов, влияющих на перемещение RS–элементов в оперон bvgAS, регулирующий вирулентность B.pertussis.

3. Выделение мутантов B.pertussis, содержащих инсерцию RS –элемента в опероне bvgAS.

4. Выделение и характеристика новых бактериофагов и лизогенности микроорганизмов рода Bordetella.

5. Конструирование тест-систем для идентификации и характеристики ДНК бактерий B.pertussis в биологическом материале от носителей и больных коклюшем детей и взрослых с помощью полимеразной цепной реакции.

Научная новизна

- клонированы повторяющаяся последовательность и транспозоно-подобная структура хромосомы B.pertussis, сконструированы их генетически маркированные варианты. Показано, что изолированные нами RS и Tn–подобная последовательности являются мобильными генетическими элементами, сходными с МГЭ других бактерий. МГЭ B.pertussis способны к RecA- независимым перемещениям, индуцируют образование дупликаций, делеций, инверсий прилегающего генетического материала и формирование коинтегратов в бактериях E.coli. Установлена зависимость RS- индуцируемых событий рекомбинации от фенотипа бактерии–хозяина. Cконструирован штамм E.coli, продуцирующий функционально-активную транспозазу RSBP B.pertussis;

- идентифицированы события спонтанного перемещения RS– элементов в сctagg сайт оперона bvgAS вирулентных бактерий B.pertussis и выделены инсерционные Bvg- мутанты B.pertussis. Установлено, что частота перемещения RS–элементов зависит от функционирования оперона bvgAS и условий культивирования бактерий B.pertussis. Перемещение RS–элементов не регистрируется в бактериях, содержащих мутацию в опероне bvgAS. Показано, что бактерии B.pertussis могут переходить в авирулентное состояние в результате интеграции RS–элементов в оперон bvgAS, регулирующий экспрессию генов вирулентности бактерий;

- выделены и охарактеризованы новые бактериофаги из бактерий международного штамма B.pertussis Tohamа I (Т) и конвертанта B.parapertussis 17903 (К), установлена лизогенность бактерий и структура геномов описанных ранее бактериофагов B.pertussis и B.bronchiseptica. Показано, что геномы всех изученных бактериофагов Bordetella, за исключением бактериофага К, идентичны. Геном бактериофага К отличается от генома Т и всех охарактеризованных бактериофагов Bordetella. Бактерий B.pertussis и B.bronchiseptica являются полилизогенами. Геном профага К находится в хромосоме клетки-хозяина, тогда как геном Т присутствует, скорее всего, в состоянии плазмиды и утрачивается в процессе культивирования большей частью бактериальной популяции. По меньшей мере, один из выделенных бактериофагов B.pertussis, родственный Т, способен лизогенизировать бактерии B.parapertussis, интегрируя фрагмент генома в хромосому, и вызывая изменение свойств возбудителя паракоклюша. Свойства охарактеризованных бактериофагов позволяют отнести их к классу мобильных генетических элементов.

Практическая значимость

Показана целесообразность использования разработанных в процессе выполнения работы тест-системы и метода выявления ДНК бактерий B.perussis, находящихся в различных фазовых состояниях, для диагностики заболевания, выявления носителей возбудителя коклюша, определения роли фазовых состояний в патогенезе и персистенции возбудителя.

Использование разработанных тест-систем для лабораторной диагностики коклюша показало их высокую эффективность в сравнении с бактериологическими методами и позволило выявить возбудитель коклюша примерно у 7% «практически здоровых» детей и более чем у 30% больных детей с диагнозом острое респираторное заболевание. Полученные нами и другими авторами результаты указывают на то, что стертая и атипичная формы коклюша является причиной значительного числа заболеваний с симптомами длительного кашля. Длительно кашляющие дети и взрослые, бессимптомные носители бактерий B.perussis, наряду с больными типичной формой коклюша, являются источником инфекции.

Разработанный экспериментальный подход позволяет идентифицировать бактерии, содержащие инсерцию RS-элементов в оперон bvgAS, регулирующий транскрипцию генов вирулентность возбудителя коклюша. Идентификация инсерционных Bvg- мутантов и мутантов по другим генам вирулентности B.perussis на разных стадиях заболевания или в организме носителей позволит определить роль RS-индуцированного мутагенеза при формировании персистирующих форм бактерий Bordetella. Исключение RS-элемента из структуры мутантного гена приводит к восстановлению вирулентного фенотипа, что может вызывать развитие инфекционного процесса в организме хозяина. Определение относительного числа инсерционных мутантов B.perussis у носителей и больных на разных стадиях заболевания может оказаться важным критерием для оценки эпидемиологической значимости носительства Bvg- мутантов и разработки новых подходов к профилактике коклюша.

Подготовлена фармакопейная статья и инструкция по применению «Тест-системы для экспресс-индикации возбудителя коклюша методом полимеразной цепной реакции», одобренные Советом по внедрению научных достижений в практику ГУ НИИЭМ им. Н.Ф.Гамалеи РАМН 7 февраля 2008 г., протокол №3.

Апробация работы.

Основные результаты работы доложены на конференции National Institute of Allergy and Infection Diseases USA research conference, June 24-30, 2006; 3-й Всероссийской научно-практической конференции «Генодиагностика в современной медицине», Москва, 2000; 2-м Всесоюзном симпозиуме теоретических и прикладных аспектов молекулярной биологии, Самарканд 1991; Всесоюзной школе-семинаре «Молекулярная биология и медицина», Ленинград, 1990; FEMS-symposium Pertussis, Berlin, 1988; 13-ой Всесоюзной конференции по электронной микроскопии «Биология и медицина», Москва 1988.

Апробация диссертации состоялась 13 декабря 2007г на совместной научной конференции отделов медицинской микробиологии, генетики и молекулярной биологии бактерий ГУ НИИЭМ им. Н.Ф. Гамалеи РАМН.

Публикации. По материалам диссертации опубликованы 34 работы, из которых 21 в рекомендованных ВАК РФ изданиях.

Структура работы.

Диссертационная работа изложена на 292 страницах, содержит введение, 3 главы («Обзор литературы», «Материалы и методы», «Результаты и обсуждение») заключение и выводы. Работа иллюстрирована 32 рисунками и 16 таблицами. Список литературы содержит 490 ссылок, из них 19 в изданиях на русском языке.

Основное содержание работы

1. Материалы и методы.

Штаммы и условия культивирования. В работе использованы штаммы E.coli, B.pertussis, B.parаpertussis B.bronchiseptica из коллекции ГУ НИИЭМ им. Н.Ф.Гамалеи РАМН. Бактерии E.coli культивировали на плотной питательной среде L(Дифко), на минимальной среде с аминокислотами или на жидкой питательной следе L(Дифко) (Миллер ДМ, 1984). Бактерии рода Bordetella культивировали на плотной питательных средах КУА (казеиново-угольный агар), БЖ (Борде-Жангу) с добавлением или без добавления 10% дефибринированной крови барана. Инсерционный мутанты E.coli metY:: pKK3 отбирали и анализировали на минимальной среде, содержащей 1 мкг/мл метионина. В качестве индикаторных сред для характеристики Pts- мутантов использовали среды Мак Конки и среду с тетразолием (Bolshakova TN, 1992), добавляя необходимые углеводы (глюкозу и фруктозу) до 1%.

Для титрования фагов Bordetella использовали полусинтетическую среду типа Cohen- Wheeler с добавлением 0.5% агара (Дифко).

Конструирование изогенных штаммов. Изогенные RecA- и RecBC-– штаммы E.coli конструировали, используя скрещивание с донорами KN502 (TetR) или GA87 (Thy+). Изогенные штаммы бактерий FruS1- и PtsH5- сконструированы в соответствии со стандартной схемой трансдукции селективных маркеров донорных штаммов LBG1605 (Glu-) и LBG1156 (Man+ ). Изогенные штаммы бактерий KmR PtsH- (LBG1623-H7) и СmR PtsI- (LBG1623-I3) сконструированы путем инсерции in vitro последовательности генов kan и cad в структуру генов ptsH и ptsI оперона pts бактерий LBG1623, любезно предоставленных нам Dr. Barry L. Wanner Department of biological sciences, Purdue University, USA. Изогенные варианты, содержащие инсерцию metY::pKK3 и другие мутанты E.coli, конструировали с помощью Р1vir трансдукции c использованием соответствующих доноров. Штаммы бактерий, содержащие рекомбинантные плазмиды pOX38::pKK3, конструировали с помощью коньюгации коинтеграта в бактерии соответствующего реципиентного штамма.

Бактерии, содержащие одну или несколько плазмид, получены с помощью трансформации соответствующих реципиентных штаммов.

Рестрикционный анализ, лигирование, электрофорез ДНК, саузерн- и гибридизацию in situ проводили в соответствии с методическим руководством ( Маниатис Т и др., 1984).

Генетические манипуляции. Трансформацию клеток E.coli плазмидной ДНК или лигированной смесью проводили в соответствии с руководством (Маниатис Т и др., 1984). Процедуры коньюгации и P1vir – трансдукци бактерий E.coli проводили по стандартным методикам (Миллер ДМ, 1984) или использовали модификации, описанные в соответствующих разделах главы «Результаты и обсуждение». Для отбора рекомбинантов (трансдуктантов, трансформантов и трансконьюгантов) использовали селективные среды, содержащие антибиотики, или минимальные питательные среды на основе среды М9 (Миллер ДМ, 1984). Бактерии B.pertussis трансформировали методом электропорации на приборе (Biorad США), согласно инструкции изготовителя.

Выделение ДНК плазмид, хромосомы, бактериофагов и продуктов ПЦР из геля проводили с помощью систем Wizard Plus SV MiniPrepsDNA purification system (Promega США), Wizard Plus MiniPrepsDNA purification system (Promega США) и Wizard SV Gel and PCR Clean-up System (Promega США).

Клонирование последовательностей ДНК проводили в соответствии с руководством (Маниатис Т и др., 1984). Инвертированные повторяющиеся последовательности ДНК хромосомы B.pertussis 475 клонировали в соответствии с методикой (Ohtsubo H, Ohtsubo E, 1976).

Полимеразную цепную реакцию (ПЦР) проводили, в соответствии с рекомендацииями (Mller FM, 1997) на приборе «Терцик» (Россия) с использованием праймеров, синтезированных АО «Синтол».

Определение нуклеотидной последовательности. Автоматическое секвенирование проводили на прибоер 373А Automatic Sequencer (Applied Biosysthems, USA) с использованием реактивов Dye Deoing Terminator ABI sequencing Kit с Taq-полимеразой FS (Perkin Elmer, USA). Для реакции использовали продукт амплификации ДНК или плазмиды, очищенные в соответствии с приведенной выше методикой.

Синтез и очистка транспозазы RSBP из бактерий E.сoli BL21/pET32 ORF1. Ночную культуру клеток рекомбинантного штамма, выращенную при 37оС в L бульоне с ампициллином, разводили в 100 раз и подращивали 3 часа. Затем добавляли IPTG до концентрации 1mM и культивировали еще 3 часа.

Очистку транспозазы из нерастворимой фракции бактерий E.сoli BL21/ pET32ORF1 проводили с помощью хроматографии на MS-His агарозе (Promega-V8500) в присутствии 6М мочевины в соответствии с инструкцией фирмы производителя. Белок анализировали методом электрофореза в 12% PAAG-геле в денатурирующих условиях по стандартной методике (Laemmli UK, 1970).

Лейкоцитозстимулирующую активность (ЛСА) коклюшного токсина, активность термолабильного токсина (ТЛТ) и видоспецифические агглютиногены бактерий B.pertussis определяли в соответствии с “Инструкцией по проверке биологических свойств вакцинных штаммов B.pertussis”. Для определения видоспецифических агглютиногенов использовали сыворотки диагностические коклюшные и паракоклюшные к агглютиногенам 1.2.3 и 14, адсорбированные, сухие (ГУ НИИЭМ им.Н.Ф.Гамалеи РАМН).

Получение фагов Bordetella в высоком титре и изучение их свойств проводили в соответствии с методами, разработанными Синяшиной ЛН и др., 1982.

Приготовление препаратов ДНК и бактериофага для электронной микроскопии осуществляли по методике (Davis R, 1971).

Исследования клинических образцов. Для исследования использовали смывы с назофарингеальных декроновых тампонов. Взятие материала проводили в соответствии с «Требованиями к взятию и транспортировке материала для лабораторной диагностики коклюша» Комитета Здравоохранения Москвы от 25 ноября 2002 года № 539/№ 230.

Выделение ДНК из клинического материала, проведение ПЦР и учет результатов описаны в ФСП и Инструкции по применению «Тест–системы для экспресс-индикации возбудителя коклюша методом полимеразной цепной реакции (ПЦР) “МастерК”»

Нерадиоактивное мечение и гибридизацию ДНК-зонда проводили по методике, разработанной (Вейко НН и др., 1989).

Статистическую обработку результатов. Использованы методы математической статистики, принятые в биологии и медицине (Гланц С., 1999).

2. Результаты и обсуждение

2.1. Повторяющиеся последовательности и транспозоно-подобные элементы B.pertussis.

Электронно-микроскопический анализ ДНК B.pertussis 475 и Tohama I выявил большое число инвертированных друг к другу повторяющихся последовательностей размером около 1.1 т.п.н., равномерно распределенных по хромосоме. Одна из структур, содержащих два инвертированных повтора, обнаружена нами вблизи оперона bvgAS, контролирующего вирулентность возбудителя коклюша.

2.1.1. Клонирование повторяющейся последовательности и транспозоно-подобного элемента хромосомы B.pertussis 475. Конструирование генетически маркированных RSВР и TnBP- элементов.

Для клонирования повторяющейся последовательности хромосомы B.pertussis 475 использован метод Ohtsubo H., Ohtsubo E. (1976). Двунитевые фрагменты, сформированные в результате обработки S1-нуклеазой гомодуплекса ДНК B.pertussis 475, содержащей инвертированные повторы, клонированы в векторе рНС79. Структура трех характерных рекомбинантных плазмид pNK1, рМК2 и рМК1, определенная с помощью рестрикционного анализа, Саузерн – гибридизации, электронной микроскопии и частичного секвенирования, представлена на рисунке 1. Последовательность RSВР идентична последовательностям RS1 и RS2 (McLafferty MA et al., 1988, McPheat W et al., 1989).

Рисунок 1. Структура плазмид, полученных в результате клонирования повторяющейся последовательности B.pertussis 475 в плазмиде рНС79.

Cos фрагмент последовательности вектора рНС79, К10F и K10R – специфические праймеры RSBP.

Транспозоно-подобный элемент (TnBP) обнаружен нами в составе BamHI фрагмента хромосомы B.pertussis 475, содержащего последовательность оперона bvgAS - регулятора транскрипции генов вирулентность бактерий рода Bordetella. Показано, что TnBP стимулирует образование recA – независимых делеций и инверсий в составе рекомбинантной плазмиды, содержащей BamHI фрагмент хромосомы. TnBP состоит из двух инвертированных друг к другу последовательностей, размером 1053 п.н. (RSBP) и 402 н.п. (RSBPi), фланкирующих внутреннюю область хромосомы 731 п.н. (рис. 2). Для дальнейшего изучения свойств RSBP и Tn-подобного элемента были скоструированы их генетически маркированные варианты. Структура рекомбинантной плазмиды рКК3, содержащей маркированный TnBP, представлена на рисунке 2.

Для конструирования маркированной, функционально активной производной RSBP, проведен компьютерный анализ последовательностей 238-и копий RS хромосомы B.pertussis Tohama I, позволивший предположить, что транспозазу RSBP B.pertussis размером 316 а.к. кодирует наибольшая из трех ORF – последовательность ORF1. Для проверки этого предположения сконструированы мутанты, содержащие инсерции гена kan, внутри или вне ORF1 RSBP B.pertussis, клонированные в составе плазмид pMu5 и pMu6, соответственно (рис. 2). Дальнейшие эксперименты показали, что только последовательность RSBP, содержащая интактную ORF1, сохранила способность индуцировать формирование межплазмидных коинтегратов и коинтегратов между плазмидой и хромосомой E.coli (см. ниже).

Рисунок 2. Физическая карта плазмид рКК3, pMu, pMu5 и pMu6, содержащих генетически маркированные элементы TnBP и RSBP.

ORF1 и ORF1- интактная и делетированная рамка считывания, кодирующая транспозазу RSBP; Xma*III – сайт рестрикразы, нарушенныу в результате лигирования с BamH1 сайтом последовательности гена kan; K10F и K10R- специфические праймеры для амплификации фрагмента последовательности RSBP

2.1.2. Cвойства RSВР и TnBP-элементов B.pertussis в бактериях E.coli.

Основное свойство мобильных генетических элементов, к числу которых, по нашему предположению, относятся RSВР и TnBP- элементы B.pertussis - их способность перемещаться между геномами и внутри одного генома. Часто, перемещение МГЭ сопровождается изменением структуры прилегающих к нему областей, проявляющееся в виде дупликаций, делеций и инверсий последовательностей ДНК мишени. Перемещение МГЭ может происходить без образования промежуточных продуктов, или сопровождаться формированием коинтегратов между ДНК донора и реципиента МГЭ (Berger B, Haas D, 2001). Для изучения событий транспозиции чаще всего используют перемещение МГЭ из плазмиды в хромосому или между двумя плазмидами.

2.1.2.1. Транспозиция (интеграция) RSВР и TnBP-элементов B.pertussis в хромосому E.coli.

Перемещение RSВР и TnBP- элементов B.pertussis в хромосому бактерий E.coli регистрировали без элиминации плазмиды-донора или после ее элиминации. Во всех случаях для доказательства хромосомной локализации RSВР, TnBP или плазмиды использовали выделение плазмидной ДНК, Р1vir трансдукцию, Саузерн-гибридизацию, ПЦР и секвенирование продуктов ПЦР.

Первая модель регистрировала события спонтанной транспозиции TnBP из плазмиды рКК3 (рис.2) в хромосому recA мутантов HfrH E.coli KS721. События транспозиции TnBP фиксировали в экспериментах по переносу маркера транспозона TnBP, переместившегося в хромосому E.coli KS721, в процессе скрещивания HfrH E.coliKS721/pKK3 х E.coli478. Изучение структуры хромосомы трансконьюганта 478–5 методами гибридизации и ПЦР показало, что она содержит только последовательность TnBP и не содержит последовательности векторной плазмиды, а структура транспозона в составе хромосомы 478–5 не отличается от структуры TnBP в составе плазмиды – донора. Эксперименты выявили высокую нестабильность транспозантов в бактериях E.coli478. Структура рекомбинантной хромосомы более стабильна в бактериях реципиента E.coli GA87 RecBCsbcB.

Вторая и третья экспериментальные модели представляют собой варианты использования метода «спасения маркера» для идентификации RSВР-индуцированных коинтегратов плазмиды рКК3 с хромосомой E.coli, основанного на применении различных методов элиминации плазмиды-донора.

Первый способ элиминации плазмид основан на подавлении их репликации в результате обработки бактерий коумермицином (Данилевская О, Грагеров А, 1980). В работе использованы RecA+ и RecA- производные штаммов Hfr KS721/pKK3 и F-5097/pKK3. Результаты экспериментов представлены в таблице 1. Частоту N1 определяли как отношение числа KmR бактериальных клонов, выросших на L-агаре с канамицином после обработки бактерий коаумермицином, к числу бактерий, выросших на L-агаре без антибиотика. Частота «спасения маркера» N2 = (n2/ n1)х N1, где n1 и n2 – число проверенных и бесплазмидных бактериальных клонов, соответственно.

Из таблицы 1 видно, что частота «спасения маркеров» плазмиды рКК3 изменяются незначительно в зависимости от recA генотипа бактерий E.coli. Подавляющее большинство бесплазмидных клонов несли оба маркера устойчивости - маркер KmR TnBP и плазмидный маркер АрR. Среди них были обнаружены ауксотрофные мутанты. Один из бесплазмидных мутантов KmRApR KS721::pKK3, с наиболее часто встречающимся фенотипом, названным нами MetY (см. «Мат. и методы»), выбран для дальнейшего анализа. Для локализации места интеграции плазмиды рКК3 в хромосому E.coli проведён комплементационный анализ мутации MetY в штамме 5097::pKK3 с помощью генов, клонированных в составе бактериофага gt11 коллекции Kochara Y. (коллекция ВНИИ Генетика). Фенотип MetY+ был восстановлен после трансдукции фагом 386, содержащим ген metY+, что позволило картировать инсерцию плазмиды в область структурного гена metY. Показано, что передача хромосомных и плазмидных маркеров в экспериментах Р1vir трансдукции от донора KmRApR MetY KS721::pKK3 проходила совместно с частотой 25-100%, независимо от генотипа реципиента, что указывает на хромосомную локализацию плазмиды рКК3 в гене metY. Структура коинтеграта 5097::pKK3 определена в результате секвенирования продуктов ПЦР с праймеров, представленных на рисунке 3.

Таблица1. Значения частот «спасения маркера» (N2) плазмиды рКК3 в бактериях E.coli.

Штамм N1 n1 (n2) N2 Ауксотрофность
KS720K RecA+ 318 х 10-6 142 (3) 6,5х 10-6 Lys, Ade
KS721K RecA- 5,33 х 10-6 54 (20) 2,0 х 10-6 Met, Lys, Trp
5097K RecA+ 1,1 х10-6 60 (58) 1,0 х10-6 Nad, Ade, His
5098K RecA- 0,2 х 10-6 47 (47) 0,2 х 10-6 Lys, Met

Рисунок 3. Структура коинтеграта хромосомы KmRApR E.coli Х5097 и плазмиды pKK3.

Стрелки с изломом - праймеры FmetY,RmetY, LRSBP, RRSBP; вертикальные стрелки указывают положение сайтов рестрикции Bgl II, использованных для клонирования интегрированной структуры.

Аналогичные результаты получены нами (см. ниже) при элиминации плазмид рКК3 из клеток мутанта recBC sbcB E.coli в результате их культивирования при 42С0.

При выращивании бактерий MetY- E.coli без антибиотиков наблюдали реверсии к фенотипу MetY+. Минимальные частоты реверсий (10-9 - 3x10-8) регистрировали в бактериях GA87(recA+recBCsbcB), 5099(recA+recBC) и KS721(recArecBC+), а максимальные (2х10-2) в бактериях 5097(recA+recBC+). Этот результат подтверждает стабилизацию рекомбинантных структур, содержащих RSBP, в RecBC SbcB мутантах или (и) указывает на различия в структуре коинтегратов, сформированных в разных штаммах E.coli.

Таким образом, в условиях подавления репликции плазмиды-донора в бактериях E.coli наблюдается, преимущественно интеграция плазмиды с хромосомой хозяина. Коинтеграт содержит плазмиду, фланкированную двумя прямыми копиями RSBР B.pertussis, интегрированную в последовательность гена metY E.coli. Структура metY::рКК3 типична для коинтегратов, сформированных известными МГЭ (Berger B, Haas D, 2001). При выращивании рекомбинантных бактерий без антибиотиков возникают реверсии к дикому фенотипу. Минимальные частоты реверсий к MetY+ наблюдали в RecBCsbcB мутантах E.coli

Как продемонстрировано выше, перемещение TnBP в хромосому E.coli, образование RS-индуцированных коинтегратов между плазмидами (см. ниже) и плазмидой и хромосомой практически не зависит от RecA системы гомологичной рекомбинации E.coli. Однако мутации RecBC SbcB кишечной палочки влияют, по крайней мере, на стабильность RS-индуцированных рекомбинантных структур и, в конечном итоге, на регистрируемые в эксперименте частоты транспозиции и образования коинтегратов в E.coli.

Согласно современным представлениям фосфоенолпируват-зависимая фосфотрансферазная система (ФТС) имеет непосредственное отношение ко многим сторонам функционирования бактериальной клетки. Наряду с другими функциями, она принимает участие в регуляции экспрессии бактериальных генов, в том числе и некоторых генов вирулентности. Паралоги ряда генов ФТС обнаружены в хромосоме B.pertussis и других бактерий (Deutscher J, Saier VJr, 2005), что делает возможным участие ФТС в регуляции процессов «незаконной рекомбинации», обеспечивающих формирование RSBP-индуцируемых коинтегратов. Для изучения зависимости частоты формирования RSBP-индуцированных коинтегратов от ФТС E.coli нами использована упомянутая выше термоэлиминация плазмид с СolE1 репликоном из клеток recBCsbcB E.coli (Basset CL, Kushner SR,1984). Донором TnBP служила плазмида рКК3, в качестве отрицательного контроля - плазмида pUC4K. Результаты эксперимента представлены в таблице 2. Частоту спасения маркеров определяли также как и в эксперименте по элиминации плазмиды рКК3 с помощью коумермицина. Из таблицы 2 видно, что плазмидные маркеры сохраняются в бактериях GA87-3 с частотой 10-6, но не наследуются клетками E.coli GA87 PtsH5 после их выращивания при 420С (частота « спасения маркера» <10-9). Фенотипическая супрессия мутации ptsH5- выращивание в среде с фруктозой и генетическая супрессия ptsH5 (мутация fruS) - увеличивают частоты «спасения маркера» до значений (10-8 и 5x10-7, соответственно). Во втором случае, частота наследования плазмидных маркеров близка к частоте, наблюдаемой в клетках дикого типа.

Таблица 2. Значения частот «спасения маркеров» плазмиды рКК3 в ptsH+ и ptsH- бактериях E.coli.

Штаммы Генотип Плазмида Частота (N2)
GA87-3 ptsH+ рKK3 10-6
GA87-4 рtsH+ рUC4K <10-9
GA87-45 рtsH5 рUC4K <10-9*
GA87-35 рtsH5 рKK3 <10-9
GA87-35 рtsH5 рKK3 10-8 *
GA87-513 рtsH5fruS1 рKK3 5x10-7

* культивирование бактерий на среде с фруктозой

Аналогичные результаты получены при изучении зависимости частоты исключения интегрированной структуры от ФТС E.coli (табл.3). Для этих целей использованы сконструированные нами PtsH+ и PtsH производные штаммов 5097-88, а также PtsH+ и PtsH изогенные штаммы LBG1623 и LBG1605, содержащие мутантный аллель metY::pKK3. События исключения рКК3 из гена metY регистрировали по изменению фенотипа бактерий от MetY KmRApR к MetY+ KmRApR. Как видно из таблицы 3 исключение рКК3 из гена metY происходит только в бактериях с фенотипом РtsH+ или в условиях фенотипической или генетической супрессии мутации рtsH5. В ряде случаев события перемещения сопровождались не только восстановлением MetY+ фенотипа, но и появлением ауксотрофности по различным аминокислотам, что указывает на возможное внутримолекулярное перемещение плазмиды рКК3.

Таблтца 3. Значения частот исключения плазмиды рКК3 в ptsH+ и ptsH- бактериях E.coli.

Штаммы Генотип Частоты перемещения
5097-88 рtsH + 2x0-7
5097-885 рtsH5 <10-9
5097-885 рtsH5 2,5x10-8*
LBG1623-88 ptsH + 2,5x10-7
LBG1623-885 ptsH5 <10-9
LBG1623-885 ptsH5 3,1x10-8*
LBG1156-88 ptsH5 fruS1 1,3x10-7

* культивирование бактерий на среде с фруктозой

Для проверки правильности определения структуры коинтеграта (рис. 3) проведено клонирование фрагмента BglII хромосомы 5097-88 размером около 10 т.п.н., содержащего рлазмиду рКК3 в составе последовательности metY. Бактериальные клоны E.coli, содержащие плазмиду ожидаемой структуры, удалось получить только при использовании для трансформации РtsH мутантов бактерий E.coli. В РtsH+ бактериях плазмида интегрировална в хромосому. Таким образом, мутация РtsH стабилизирует не только структуру хромосомы, но и рекомбинантных плазмид, содержащих RSBP B.pertussis. Это наблюдение указывает на целесообразность использования РtsH мутантов E.coli для клонирования RS–элементов B.pertussis и, возможно, других мобильных генетических элементов. Результаты рестрикционного и гетеродуплексного анализа ДНК плазмиды, содержащей фрагмент BglII хромосомы 5097-88, подтвердили правильность структуры, изображенной на рис. 3.

Представленные экспериментальные результаты позволяют сделать следующие выводы:

- транспозоноподобная структура TnBР может перемещаться из плазмиды в хромосому E.coli;

- в условиях подавления репликции плазмиды-донора в бактериях E.coli наблюдается, преимущественно интеграция плазмиды с хромосомой хозяина;

- структура коинтеграта E.coli (metY::рКК3) типична для коинтегратов, формируемых известными МГЭ;

- плазмида рКК3 способна к точному (почти точному) исключению из хромосомы коинтеграта E.coli (metY::рКК3);

- частоты RSBP-индуцируемых интеграций, исключения плазмиды рКК3, и внутримолекулярного перемещения рКК3 по хромосоме E.coli, зависят от генотипа бактерий;

- частоты RSBP-индуцируемых событий рекомбинации значительно снижены в РtsH мутантах E.coli. Фенотипическая или генетическая супрессия мутации ptsH восстанавливает RSBP- индуцируемую интеграцию и исключение рКК3 из гена metY.

2.1.2.2. Картирование открытой рамки считывания, ответственной за синтез транспозазы RSВР. Формирование и разрешение RSВР индуцируемых межплазмидных коинтегратов в бактериях E.coli.

Определение последовательности RSBP и потенциальных рамок считывания, ответственных за синтез транспозазы, имеющийся набор инсерционных мутантов RSBP позволили перейти к картированию гена, кодирующего транспозазу RSBP. Для этого, были проведены эксперименты, регистрирующие события формирования коинтегратов между плазмидами pMu, pMu5 и pMu6, содержащими интактную и мутантную последовательности ORF1 RSBP (рис. 2), и коньюгативной плазмидой рОХ38G, содержащей маркер устойчивости к гентамицину, а также хромосомой E.coli. Для регистрации событий RSBP-индуцированной интеграции использован описанный выше метод, термоэлиминации плазмид pMu, pMu5, рКК3 и pMu6 из клеток recBCsbcB E.coli, и метод (Galas DJ,Chandler M, 1982), разработанный для анализа межплазмидных коинтегратов. Формирование RSBP-индуцированных коинтегратов между плазмидами pMu, pMu5, pMu6, рКК3 и плазмидой рОХ38G регистрировали в бактериях PolA E.coli, в которых не возможна репликация плазмид – доноров RSBP(TnBP), содержащих репликон ColE1. Разрешение коинтегратов pMu(pMu5, рКК3)::рОХ38G наблюдали в PolA+ бактериях E.coli.

Результаты экспериментов, представленные в таблице 4 и 5. «Спасение маркера» наблюдается только у плазмид pMu, pMu5, рКК3 содержащих интактную ORF1 RSВР (определении значение N2 см. выше).

Таблица 4. Частоты «спасения маркера» плазмид в бактериях E.coli GA87

Штамм Плазмида(маркер) Частота (N2) Ауксотрофность
GA87-1 pMu (KmR) 1,5х 10-8 Н.О.
GA87-3 pKK3(KmRApR) 1,2х 10-6 Met, Lys, Trp Ade,
GA87-4 pUC4K( KmRApR) <10-9
GA87-5 pMu5 (KmRApR) 0,5х10-8 Trp
GA87-6 pMu6 (KmRApR) <10-9

Межплазмидные коинтеграты с рОХ38G, формирование которых регистрируются по передаче макеров KmR или ApR (для pMu) в скрещиваниях бактерий RecA-E.сoli 1605pOX38G/pMu5(pMu, pKK3, pMu6, pUC4K) x E.сoli KS164, также образуются только с плазмидами, содержащих интактную ORF1 RSВР. Образование межплазмидных коинтегратов удалось зарегистрировать только в бактериях PtsH+ Е.coli LBG1605 или в PtsH5 мутантах Е.coli в присутствии фруктозы или в результате генетической супрессии мутации рtsH. Все проверенные KmR трансдуктанты (по 50 из каждого скрещивания) содержали маркера ApR.

Таблица 5. Частоты передачи маркеров устойчивости при скрещивании RecA-E.сoli 1605pOX38G/pMu5(pMu6, pMu, pKK3, pUC4K)xE.сoli KS164

Штамм Донор Основной генотип Частота передачи маркеров
GnR KmR ApR
LC839-3 рtsH +recA-/F-/pOX38G +pKK3 2х10-2 3х10-5 Н.О.
1605-1 рtsH5recA-/pOX38G+pMu 2х10-2 - <10-9
1605-1 рtsH5recA-/pOX38G+pMu 1.2х10-2 - 4х10-6 *
1605-3 рtsH5recA-/pOX38G+pKK3 2х10-2 10-7 Н.О.
1605-3 рtsH5recA-/pOX38G+pKK3 2.6х10-2 6х10-5 * Н.О.
1605-4 рtsH5recA-/pOX38G+pUC4K 1.7х10-2 <10-9 Н.О.
1605-4 рtsH5recA-/pOX38G+pUC4K 2х10-2 <10-9 * Н.О.
1605-5 рtsH5recA-/pOX38G+pMu5 1.5х10-2 <10-9 Н.О.
1605-5 рtsH5recA-/pOX38G+pMu5 1.5х10-2 1.6х10-6 * Н.О.
1605-6 рtsH5recA-/pOX38G+pMu6 1.4х10-2 <10-9 Н.О.
1605-6 рtsH5recA-/pOX38G+pMu6 1.2х10-2 <10-9 * Н.О.

* культивирование бактерий на среде с фруктозой; Н.О.- не определяли.

Для плазмиды pMu6, содержащей дефектную ORF1 (рис.2), и плазмиды pUC4K, не содержащей RSBP, «спасения маркеров» и образования коинтегратов с плазмидой pOX38G не зарегистрировано.

Таким образом, результаты экспериментов, представленные в таблицах 4 и 5, показывают, что события RSВР-индуцированного образования межплазмидных коинтегратов и коинтегратов между плазмидой и хромосомой E.coli происходят только при наличии интактной последовательность ORF1 в составе RSВР плазмиды-донора. RSВР-элемент, содержащий исерцию внутри ORF1, утрачивает способность индуцировать образование коинтегратов, что в совокупности с результатами компьютерного анализа аминокислотной последовательности ORF1 (см. ниже), указывает на кодирование транспозазы RSВР B.pertussis последовательностью ORF1. Образование межплазмидных коинтегратов, коинтегратов между плазмидой и хромосомой и перемещение интегрированных структур внутри хромосомы, с максимальной частотой наблюдается в клетках E.coli с интактным ptsH аллелем или в условиях супрессии мутации ptsH.

Согласно классической схеме межмолекулярной транспозиции МГЭ, на первом этапе могут формироваться коинтеграты, состоящие из двух плазмид - донорной, фланкированной двумя прямыми повторами МГЭ, и реципиентной. Продуктами разрешения коинтеграта, обычно, является плазмида донор и плазмида реципиент, содержащая одну копию МГЭ. Разрешение коинтегратов может обеспечиваться резольвазами, кодируемыми МГЭ, ферментами гомологичной рекомбинации клетки-хозяина или теми и другими вместе (Berger B, Haas D, 2001).

Для определения структуры коинтеграта и продуктов его разрешения использованы коинтеграты плазмид рОХ38G и рКК3, полученные в штамме E.coli LC839/pOX38G + рКК3 и переданные в результате коньюгационного скрещивания в PolA мутант E.coli KS164. Плазмидная ДНК из пяти трансконъюгантов (KS164-1, KS164-2, KS164-9, KS164-11, KS164-14) проанализирована с помощью методов электронной микроскопии и Саузерн-гибридизации. Все PolA- трансконъюганты E.coli содержали только одну плазмиду с молекулярным весом большим, чем pOX38G в составе которой, находится только одна копия TnBP. Наличие в коинтеграте только одной копии TnBP указывает на то, что в образовании коинтеграта, в процессе формирования которого обычно происходит дупликация МГЭ, принимает участие не весь транспозон, а только RSBP. Результаты Саузерн-гибридизации фрагментов рестрикции плазмидных ДНК с Р32 меченным RSBP подтвердили этот вывод и выявили интеграцию плазмиды рКК3 в три различных EcoRI фрагмента плазмиды рОХ38. В коинтеграте KS164-1 обнаружена делеция примыкающей к RSBP последовательности гена traN плазмиды рОХ38G.

Таким образом, в ходе описанных экспериментов показано, что слияние репликонов pKK3 и pOX38G обусловлено активностью RSBP, и образование коинтегратов с его участием происходит согласно классическим схемам. Рекомбинантная молекула состоит из реципиентной плазмиды pOX38G, донорной плазмиды рКК3 и двух последовательностей RSBP, прямо ориентированных к другу (аналогично структуре коинтеграта на рис. 3). Выявлено три участка интеграции плазмиды рКК3 в плазмиду pOX38G. Находясь в составе коинтеграта, RSBP сохраняет способность индуцировать образование делеций протяженных сегментов ДНК, прилегающих к сайту интеграции.

Для изучения продуктов разрешения коинтегратов использовали описанные выше коинтеграты pOX38G::pKK3. Разрешение коинтегратов регистрировали по появлению двух плазмид в бактериях RecA- E.coli Х5098 и RecA+ E.coli Х5097 после их скрещивания с донорами Pol- KS164/pOX38G::pKK3 ( KS164-1, KS164-2, KS164-9, KS164-11, KS164-14). В скрещиваниях с участием четырех доноров KS164-2, KS164-9, KS164-11, KS164-14 трансконьганты отбирали с частотами около 10-2/клетку донора. Как и следовало ожидать, трансконъюгантов в скрещиваниях с донором KS164-1, содержащим делецию traN pOX38G, не обнаружено. В клетках всех трансконьюгантов, независимо от генотипа реципиента, присутствовала «тяжелая» и «легкая» плазмиды. «Легкая» плазмида во всех, трансконьгантах, за исключением KS164-2 х Х5097, по размеру и профилю рестрикции совпадала с pKK3, что позволяет говорить о правильном разрешении коинтегратов независимо от функциональной активности системы гомологичной рекомбинации клетки-хозяина. Исходя из традиционных представлений о механизмах разрешения RS-индуцированных коинтегратов, можно ожидать, что плазмида большего размера является вторым продуктом разрешения коинтеграта, и состоит из плазмиды pOX38G и TnBP или RSBP. Для проверки этого предположения проведены скрещивания между различными вариантами доноров Х5097/pOX38G::TnBP и реципиентами E.coli HB 101 и E.coli KS164 с селекцией по маркеру KmRTnBP или GmR плазмиды pOX38G. Полученные результаты, независимо от селективного маркера, выявили стабильное сцепленное наследование маркеров плазмиды pKK3 и pOX38G при скрещивании с обоими реципиентами. ДНК «легкой» плазмиды, выделенной из клеток трансконьгантов E.coli HB101, совпадала по размеру и картине рестрикции с плазмидой pKK3.

Структура «тяжелых» плазмид была установлена при анализе ДНК, выделенной из клеток трансконьгантов PolA-E.coli KS164. «Тяжелые» плазмиды не отличались от коинтегратов pOX38G::рКК3, независимо от использованного для селекции маркера. При разрешении коинтеграта всегда регистрировали плазмиду рКК3 и вторую плазмиду, идентичную исходному коинтеграту.

Таким образом, формирование RSBP-индуцируемых межплазмидных коинтегратов и коинтегратов между плазмидой и хромосомой E.coli происходит только при участии рекомбинантных плазмид, содержащих интактную последовательность ORF1 в составе RSВР. Этот результат подтверждает вывод о кодировании транспозазы RSВР последовательностью ORF1. Структура коинтегратов соответствует структуре, описанной для коинтегратов ряда известных IS-элементов, однако их разрешение в бактериях E.coli происходит иначе. В отличие, например, от IS1-индуцированных коинтегратов, (Хесин РВ, 1984) продуктами разрешения коинтеграта pOX38G::рКК3 является плазмида pKK3 и плазмида, структура которой не отличается от исходного коинтеграта. Процесс разрешения и образования RSВР-индуцированных коинтеграта не зависит от RеcA системы гомологичной рекомбинации клетки-хозяина.

2.1.2.3. Суперпродукция и функциональная активность транспозазы RSBP B.pertussis в бактериях E.coli.

Транспозазы некоторых IS-элемнтов выделены и охарактеризованы, в других случаях, проведен анализ последовательностей соответствующих генов и предсказаны домены, обеспечивающие ферментативные функции и их связывание с ДНК (см. например, Mahillon J., Chandler M., 1998). Компьютерный анализ открытых рамок считывания RSBP показал, что только последовательность ORF1 может кодировать белок, обладающий характерной для транспозаз структурой. Каталитический D139D217E253 домен транспозазы RSBP B.pertussis предположительно локализован в области 120-290 а.к. С- конца, а ДНК- связывающий домен – в области 25-115 а.к. N - конца белковой молекулы, однако, окончательное определение структуры и положения активных центров возможно только в результате экспериментов, определяющих функциональную активность соответствующих мутантных белков. Подавляющее большинство транспозаз имеют размер более 200 а.к. и высокое значение pI от 9,48 у IS3 до 11.85 у IS30 (Mahnc Braam LA, Reznikoff WS, 1998, Stalder R. et al., 1990). Расчетная молекулярная масса гипотетической транспозазы RSBP B.pertussis составляет 36кДа (316 а.к.), а её изоэлектрическая точка определяется значением pI=11,4, что вполне укладывается в разброс значений соответствующих параметров транспозаз прокариот, определенных экспериментально или теоретически. Значения pI и размеры белков, кодируемых двумя оставшимися рамками считывания (ORF2 и ORF3) RSBP составляют (4,46 и 12,18) и (133 и 127 а.к.), соответственно, и не входят в интервал значений, характерных для транспозаз. Расчетные характеристики, белка кодируемого ORF1, а также приведенные выше результаты функционального анализа мутантов RSBP позволили заключить, что ORF1 кодирует транспозазу RSBP B.pertussis и приступить к конструированию штамма-продуцента.

В качестве вектора экспрессии ORF1 RSBP в клетках E.coli выбрана плазмида pET32 содержащая Т7 промотор, T7-терминатор и последовательность, кодирующую полигистидин, предназначенный для очистки рекомбинантных белков на никель – содержащих колонках. Так как нами установлено, что рекомбинантные структуры, содержащие RSBР, более стабильны в клетках ptsH мутанта E.coli LBG1605, клонирование продукта ПЦР, содержащего ORF1 RSBP, в векторе pGem проведено в бактериях E.coli LBG1605. Фрагмент (NdeI-XhoI), содержащий ORF1 в составе плазмиды pGem4, переклонирован в вектор экспрессии pET32. Рекомбинантная плазмида рЕТ32ORF1 использована для трансформации клеток BL21(DE3) (далее BL21), содержащих ген РНК-полимеразы фага Т7 в составе хромосомы. Транскрипция гена РНК-полимеразы обеспечивается индуцибельным Lac-промотором E.coli.

Рекомбинантные клетки E.coli BL21/рЕТ32ORF1, выращенные в присутствии IPTG, центрифугировали, осадок ресуспендировали и разрушали в дезинтеграторе Fisher Sonic Dismembrator 300. Лизат бактерий центрифугировали при 10000 об/мин, супернатант и осадок использовали для электрофореза. Результаты электрофореза суммарных белков из клеток двух независимых клонов E.coliBL21/рЕТ32ORF1, выращенных в условиях репрессии и индукции Lac–промотора, и препаратов растворимой и нерастворимой фракций индуцированной культуры представлены на рисунке 4 а и б. Как видно из рисунков, в условиях индукции, бактерии синтезируют рекомбинантный белок размером 36 кДа (дале р36) (дор. 2, 4 рис. 4 а). Масса белка, синтезированного в условиях индукции, совпадает с ожидаемым размером продукта экспрессии ORF1. Количество рекомбинантного белка достигает 10%-20% от тотального белка клетки. Практически весь белок находится в нерастворимой фракции, по-видимому, в тельцах включения (дорожка 3 рис. 4 б). При культивировании клеток E.coli BL21/ рЕТ32ORF1 в условиях репрессии Lac–промотора продукции белка не наблюдается.

Рисунок 4. Электрофореграмма белков бактерий штамма BL21-pET32ORF1, (а) выращенных без добавления IPTG (дор. 1, 3) и в присутствии IPTG (дор. 2, 4). (б)- Растворимая (дор. 2) и нерастворимая (3) фракция бактериальных клеток, выращенных в присутствии IPTG. Дор.1– маркер 14,18, 25, 35,45, 66 кДа.

а)

б)

Несмотря на то, что основная масса белка р36 находится в нерастворимой фракции клеток штамма-продуцента, нами были предприняты попытки выделения очищенной транспозазы RSBP для определения её активности в экспериментах in vitro. Для этого, растворимую и нерастворимую фракции индуцированных IPTG бактерий BL21/pET32RS наносили на колонки, содержащие Ni-NTA агарозу, и после двухэтапной эллюции белка буфером с концентрацией имидозола 250мМ рН 5.7 и рН 4,5 анализировали с помощью SDS-электрофореза. Хроматография нерастворимой фракции лизатов бактериальных клеток позволила выделить 1,5 мг белка в концентрации 100 мкг/мл, содержащего менее 10% примесей. Нам не удалось идентифицировать искомый белок при исследовании растворимой фракции концентрата 200 мл бактериальной культуры. Изменение условий культивирования рекомбинантных бактерий E.сoli BL21/pET32ORF1 (температуры, времени инкубации и концентрации IPTG), попытки перевода очищенного белка из денатурированного состояния (раствора в 6М мочевине) в фосфатный буфер (50мМ фосфатного буфера рН7,2 25мМ NaCl, 5мМ -меркаптоэтанола) с помощью ступенчатого диализа раствора белка против буферов того же состава, но содержащих меньшую концентрацию мочевины, использование для диализа различных температурных режимов и концентраций белка, вплоть до 10 мкг/мл, не привели к положительному результату.

Невозможность определения активности рекомбинантного белка в in vitro, потребовала разработки экспериментальной модели для тестирования ее активности in vivo в бактериях E.coli штамма-продуцента бела. Для этого нами сконструирована система «дефектный RSBP - плазмида-помощник». Транспозицию RSBP, «дефектного» по гену транспозазы, должна обеспечить транспозаза, кодируемая “плазмидой-помощник”. Функциональную активность транспозазы определяли в бактериях штамма-продуцента содержащих RSBP, инактивированный инсерцией гена kan, клонированный в составе рекомбинантной плазмиды pVV1 (ApS дериват плазмиды pMu6). Интегранты отбирали после индуцированной коумермицином элиминации плазмидной ДНК из клеток BL21/рЕТ32ORF1+ pVV1 (см. выше). Из 100 KmRApS бесплазмидных клонов BL21/рЕТ32ORF1 + pVV1, 5 клонов проанализированы с помощью P1vir трансдукции. Наличие последовательностей гена kan и RSBP в клетках донора и трансдуктантов подтверждено методом ПЦР, что указывает на интеграцию плазмиды pVV1, содержащей «дефектный» RSBP, или транспозицию «дефектного» RSBP в хромосому BL21.

Таким образом, использованная нами система позволила, идентифицировать события интеграции плазмиды pVV1 (или транспозиции «дефектного» RSBP) в хромосому клеток BL21/рЕТ32ORF1+ pVV1, что указывает на наличие функциональной активности у транспозазы RSBP B.pertussis, синтезированной в клетках E.coli.

Другим проявлением активности транспозазы является выявленное нами снижение выживаемости рекомбинантных штаммов BL21/pET32ORF1 в условиях индукции IPTG. Изучение культуральных свойств бактерий рекомбинантных штаммов BL21/pET32ORF1 показало, что на L- агаре с Ap и 1mM IPTG, титр бактерий в раз меньше чем на L- агаре, а выжившие ApR бактерии не способны продуцировать белок р36. Можно предположить, по крайней мере, две причины гибели клеток: продукция кодируемого ORF1 белка нарушает деление клеток или подавляет репликацию плазмиды pET32ORF1, обеспечивающей синтез -лактомазы (ApR).

Эксперименты показали, что бактерии BL21/pET32ORF1, выжившие в условиях суперпродукции транспозазы в присутствии антибиотика, сохранили исходную плазмиду pET32ORF1 и приобрели хромосомную мутацию, нарушающую синтез транспозазы. Результаты, демонстрирующие влияние суперпродукции транспозазы Tn5 на выживаемость бактерий E.coli, опубликованы Yigit H, Reznikoff WS, 1998. Ими показано, что в условиях суперпродукции транспозазы, выживают бактерии (с частотой 10-4), содержащие одну из четырех хромосомных мутации stk. Картированные ими мутации снижают активности транспозазы, но не влияют на уровень её продукции. Обнаруженная нами мутация, напротив, приводит к нарушению синтеза транспозазы и, вероятно, затрагивает ген T7-РНК-полимеразы.

Для определения возможной роли транспозазы RSBP в ингибировании репликации плазмиды pET32ORF1 проведена оценка выживаемости бактерий BL21/pET32ORF1+pMu6. Плазмида pMu6 (рис. 2) имеет схожую структуру и механизм репликации с плазмидой pET32ORF1. Эксперименты, проведенные по описанной выше схеме, показали, что выживаемость рекомбинантных бактерий BL21/pET32ORF1+pMu6, выращенных в присутствии ампициллина и IPTG, снижалась в 200 раз (а не в 104, как было определено для клеток BL21/pET32ORF1). Выжившие клетки содержали только плазмиду pMu6. Полученные результаты демонстрируют влияние транспозазы B.pertussis на репликацию СolE1 плазмид pET32ORF1 и pMu6 в клетках E.сoli и демонстрируют специфическую функциональную активность рекомбинантного белка р36, продуцируемого бактериями E.сoli.

Таким образом, в результате работы, направленной на конструирование продуцента транспозазы и изучению её свойств, получены следующие результаты:

- сконструирован штамм E.coli, продуцирующий функционально - активную транспозазу RSBP B.pertussis;

- получены очищенные препараты транспозазы RSBP в растворе 6м мочевины. Основная масса транспозазы, синтезируемой бактериями BL21/рЕТORF1, находится в нерастворимой фракции.

- разработана система «дефектный RSBP – плазмида помощник», выявляющая функциональную активность рекомбинантной траспозазы в клетках штамма-продуцента E.coli;

- культивирование бактерий BL21/рЕТORF1 в условиях синтеза транспозазы в присутствии антибиотика снижает их выживаемость. Выжившие бактерии утрачивают способность синтезировать транспозазу в результате хромосомной мутации.

2.1.2.4. Неопределенность границ повторяющейся последовательности RSBP хромосомы B.pertussis.

Повторяющиеся последовательности обнаружены в хромосомах всех представителей рода Bordetella. Установлено, что помимо IS481(RSBP) и IS1002 в хромосоме B.pertussis Tohama I, присутствует близкая к ним по размеру IS1663 (Parkhill J et al., 2003). Определение последовательности первых клонированных копий RS В.pertussis, в том числе и RSBP В.pertussis 475, показало, что они состоят из 1053 п.н., включающих в себя почти совершенные концевые инвертированные повторы размером 28 п.н. (McPheat W, McNelly T, 1997). Проведенный нами анализ последовательности хромосомы B.pertussis Tohama I выявил высокую консервативность концевых последовательностей IS481(RSBP). Из 238 копий IS481, 181 - содержит совершенный прямой повтор ctag на обоих концах последовательности, у 44 копий - одна из двух последовательностей ctag содержит одну замену, в 13 копиях - по одной замене обнаружено в обеих фланкирующих последовательностях ctag. Так как высокая консервативность концевых последовательностей, участвующих в связывании с транспозазой, типична для большинства известных IS-элементов, то правильность определения границ последовательности IS481(RSBP) не вызывала сомнений. Не характерным для IS–элементов, являлось отсутствие дупликации последовательностей ДНК-мишени, фланкирующих большинство клонированных разными авторами копий RS-элементов В.pertussis. Отсутствие дупликаций последовательностей ДНК-мишени может быть связано с особенностью IS481(RSBP) или указывать на неточность определения его границ.

Логично предположить, что структура RSBP, в том числе и последовательность концевых нуклеотидов, не зависит от бактерий в которых происходит его перемещение. Нами был проведен анализ последовательностей ДНК мишени в сайтах интеграции RSBP в бактериях E.coli и В.pertussis.

Эксперименты, позволившие зарегистрировать события спонтанной транспозиции RSBP и IS1002 в специфический сайт cctagg оперона bvgAS B.pertussis, описаны в следующем разделе диссертации. Для настоящего обсуждения важно отметить, что перемещение произошло в сайт cctagg, последовательность которого совпадает с нуклеотидами, отнесёнными к IS481(RSBP). Показано, что перемещение RSBP сопровождается дупликацией последовательности cctagg ДНК-мишени.

Аналогичные результаты получил S.Stibitz (1998), при изучении бактерий B.pertussis, выживших в условиях суперпродукции BvgAS. Оказалось, что выжившие бактерии содержат инсерцию IS481 или(и) IS1002 в ctag и gtag сайтах последовательности bvgAS. Так же как, и в наших экспериментах, IS–элементы в сайте интеграции фланкированы прямыми повторами соответствующих последовательностей ДНК-мишени.

Полученные результаты позволили заключить, что RSBP (IS481) состоит из 1043 п.н., включая концевые инвертированные повторы размером 23 п.н., а последовательность NctagN является частью ДНК хромосомы B.pertussis. В таком случае, приведенный выше анализ последовательностей копий RSBP(IS481), и полученные экспериментальные результаты не только заставляют пересмотреть размер повторяющейся последовательности хромосомы B.pertussis, но указывают на высокую специфичность их транспозиции в клетках возбудителя коклюша. Последовательность NctagN, предпочтительная для транспозиции RSBP в бактериях B.pertussis, содержит терминирующий кодон tag, обеспечивающий терминацию трансляции транспозазы RSBP, кодируемой ORF1. Таким образом, если RSBP имеет размер 1043 п.н., то “корректная” терминация синтеза кодируемой им транспозазы в бактериях B.pertussis наступает в том случае, когда RSBP перемещается в специфический NctagN сайт ДНК-мишени. Это наблюдение указывает на возможность регуляции транспозиции RSBP(IS481) на уровне регуляции синтеза его транспозазы. Схожий механизм предполагается для регуляции транспозиции ряда МГЭ. Терминирующий кодон отсутствует в последовательности IS240 (Mahillon J, Chandler M, 1998), IS427 (De Meirsman C, Van Soom C, 1990), ISMk1 (Muriani F et al., 1993), IS870, ISrf1(Fournier P et al., 1993). Некоторые из них перемещаются в последовательности, содержащие или формирующие терминирующий кодон в результате транспозиции.

Подобная схема регуляции может быть реализована и при транспозиции RSBP в бактериях E.coli. То есть, если RSBP размером 1043 п.н. перемещается в бактериях E.coli, сохраняя свои концевые последовательности (tgt ……aca), то его способность к последующим перемещениям зависит от наличия в сайте интеграции терминирующего кодона. Анализ определенных нами последовательностей на границе RSBP в плазмидах pMK2, pNK1, а также хромосомы коинтеграта metY::pKK3 E.coli позволяет сделать следующие выводы:

- на границе 3’ конца RSBP (… ttсaca) плазмиды pMK2 расположена последовательность cctaac, содержащая триплет taa, способный обеспечить «корректную» терминацию ORF1 RSBP. Последовательность cctaac близка к консенсусу NctagN и состоит из нуклеотидов ccta неизвестного происхождения и ac, принадлежащих последовательности гена rpoC. Нельзя исключить, что последовательность ccta захвачена, как часть последовательности хромосомы B.pertussis в процессе клонирования RSBP;

- последовательность pNK1, граничащая с ОRF1, не имеет терминирующего кодона. Ближайший терминирующий кодон, расположенный в структуре cos- последовательности, находится на расстоянии 34 аминокислоты от последней аминокислоты, кодируемой ORF1;

- на границе 3’ конца RSBP (… ttсaca) в хромосоме metY::pKK3 расположены нуклеотиды ccta, совпадающие с нуклеотидами неизвестного происхождения, обнаруженными на границе RSBP плазмиды pMK2. Аналогично с описанным выше примером, первые нуклеотиды gt последовательности metY, дополняют последовательность ccta до канонической cctagt (NctagtN), содержащей терминирующий TAG кодон для ORF1 RSBP. Однако в отличие от рМК2, последовательность ccta не могла оказаться в составе рекомбинантной плазмиды в результате клонирования повторяющейся последовательности хромосомы. Следовательно, в процессе RSBP индуцированной интеграции плазмиды рКК3 в ген metY E.coli, произошло копирование пограничной последовательности TnBP, присутствующей в плазмиде рКК3, возможно, в результате репарации однонитевых брешей, возникающих при разрезании ДНК рКК3 в процессе ее интеграции в ДНК-мишени;

- дупликаций последовательностей ДНК мишени в плазмидах pMK2, pNK1 и коинтеграте metY::рКК3 не обнаружено;

- делеции, стимулируемые RSBP в бактериях E.coli, могут включать последовательности RSBP и прилегающие участки ДНК-мишени. В формировании делеций могут принимать участие короткие последовательности идентичные концевым нуклеотидам RSBP;

- транспозиция RSBP может регулироваться, по-видимому, на уровне регуляции синтеза его транспозазы.

Таким образом, в отличие от транспозиции RSBP в бактериях B.pertussis, анализ последовательности сайтов интеграции плазмиды рКК3 и участков, примыкающих к концам RSBP, в плазмидах рМК2 и pNK1, сформированных в бактериях E.coli, не позволил отнести нуклеотиды cctagg к последовательности ДНК-мишени и подтвердить, что размер RSBP составляет 1043 п.н.. Особенный интерес вызывают нуклеотиды ccta, обнаруженные в коинтеграте metY::рКК3 и в плазмиде рМК2, которые, с одной стороны, близки к концевым нуклеотидам RSBP размером 1053 п.н., а с другой, являются частью последовательности ДНК-мишени, специфичной для перемещения RSBP размером 1043 п.н. в бактериях B.pertussis.

Приведенные выше рассуждения исходили из предположения, что размер RSBP составляет 1043 п.н., основанного на результатах анализа участков интеграции RSBP в оперон bvgAS. Если исходить из более ранних оценок размера RSBP - 1053 п.н. (McPheat W, 1987), то нуклеотиды ccta следует отнести к концевой последовательности NctagN RSBP. Отсутствие последовательности ctag на другом конце RSBP, в составе обсужденных выше рекомбинантных структур E.coli, объясняется её делетированием в процессе RSBP-индуцированных рекомбинаций. В таком случаи, обнаруженная нами в бактериях B.pertussis, высокая консервативность последовательностей сайтов интеграции RSBP, обусловлена полной или почти полной идентичную его концевых нуклеотидов и сайтов интеграции (NctagN). Такая возможность кажется вполне вероятной, хотя и не описана в известных нам литературных источниках.

Таким образом, имеющиеся в настоящее время экспериментальные данные не позволяют сделать окончательный выбор в пользу одной из обсужденных выше возможностей и однозначно определить границы RSBP.

2.2. IS- индуцируемая фазовая изменчивость Bordetella pertussis.

Одной из характерных особенностей возбудителя коклюша является высокая степень изменчивости его фенотипических признаков in vitro и in vivo. Изучению механизмов фазовой изменчивости B.pertussis посвящены многочисленные исследования последних десятилетий. Были выделены, фазовые варианты лишенные всех факторов вирулентности, в результате мутации сдвига рамки, мелких делеций, инверсий коротких последовательностей и инсерций в опероне bvgAS (Stibitz S, et al., 1989, McGillivray DM et al. 1989, Monack D et al. 1989). Обсуждалась возможность участия IS Bordetella в формировании авирулентных фазовых вариантов B.pertussis и B.bronchiseptica.

Цель настоящего раздела – изучение возможности формирования IS-индуцированных фазовых переходов бактерий B.pertussis. Определение основных направления исследования регуляции и значения фазовых переходов для адаптации бактерий рода Bordetella к условиям обитания.

2.2.1. Разработка метода идентификации транспозиции RSBP в бактериях B.pertussis.

Отсутствие разработанных генетических методов исследования и сложность культивирования бактерий привели к необходимости использования непрямых методов, основанных на идентификации событий перемещения RSBP в специфические участки хромосомы B.pertussis, выявленные в предыдущем разделе работы. Так как одним из наиболее важных для функционирования и вирулентности бактерий рода Bordetella является оперон bvgAS, сайт CctagG в его структуре выбран в качестве объекта для изучения транспозиции IS-элеменов в клетках B.pertussis.

Рис 5 Структура фрагмента хромосомы содержащего инсерцию RSBP (IS1002) в сctagg сайт оперона bvg AS B. pertussis

а) Схема расположения анализируемых последовательностей и праймеров, использованных для анализа структуры.

б) Фрагмент последовательности продукта ПЦР (SF-Bp2) ДНК B.pertussis 5.

cctcgccaaacgcaacaatctcgCctagGtgtgaagattcaa

в) Фрагмент последовательности продукта ПЦР (SF-AR) ДНК мутанта B.pertussis 5, не обладающего гемолитической активностью.

…cctcgccaaacgcaacaatctcgСCTAGCtgtgatgtctcaa……………ttagaattcgacaCCTAGcgccgggcat

Последовательности RSBP (б) и IS1002(в) обозначены курсивом; последовательность оперона bvg – обычным шрифтом и подчеркнута; сайт интеграции обозначен большими буквами (СCTAGG).

События перемещения регистрировали с помощью метода ПЦР. Для этого выбраны праймеры SF-АR (рис. 5), фланкирующие CctagG сайт оперона bvgAS, и праймеры, которые могли бы, в сочетаниях с SF и AR, сформировать продукты амплификации при наличии в популяции клеток бактерий, содержащих искомые интеграции RSBP (рис.5).

Некоторые из возможных сочетаний праймеров и расчетные размеры соответствующих фрагментов амплификации представлены в таблице 6. В качестве матриц для амплификации выбрана ДНК хромосом Bvg+ штаммов B.pertussis Tohama I, B.pertussis 5 и 35, а также авирулентных Bvg- штаммов B.pertussis IV и B.pertussis Tohama 347. Результаты амплификации представлены на рисунке 6.

Таблица 6. Размер расчетных продуктов ПЦР (п.н.) ДНК, содержащей RSBP в сctagg- сайте оперона bvgAS.

Сочетание праймеров Размер ПЦР продукта 1-ая ориентация RSBP Размер ПЦР продукта 2-ая ориентация RSBP
SF - Bp2 - 236
SF - K10F 529 -
SF - K10R - 926
SF - AR 1779 1779

Рисунок 6. Электрофореграмма продуктов ПЦР ДНК B.pertussis, выделенных из бактерий, выращенных на среде КУА.

Праймеры SF-AR (дор. 1-7), SF-Bp2 (дор. 8-14); 1, 8 – Н2О; 2,9- B. pertussis TohamaI; 3,10 -B. pertussis 5; 4,11-B. pertussis 35; 5,12-B. pertussis IV; 6,13- B. pertussis 347; 7,14 - B. pertussis IVK; 15- Маркер (170, 310, 480, 620, 1570 н.п).

Как видно из рисунка 6, продукты ПЦР (SF- AR) всех использованных матриц имеют размер, соответствующий расчетному размеру- 731 п.н. В ПЦР ДНК хромосом Bvg+ B.pertussis Tohama I, B.pertussis 5, B.pertussis 35 и праймеров SF – Вр2 образуются фрагменты ожидаемого размера 236 п.н. и 926 п.н. (дор. 9,10, 11) и SF – К10R (результаты не представлены). ПЦР ДНК хромосом авирулентных Bvg- штаммов B.pertussis IV и B.pertussis 347 с праймеров SF – Вр2 и SF – К10R продуктов амплификации не выявила (дор. 12 и 13). Продуктов амплификации не обнаружено и в нестед - ПЦР ДНК хромосом авирулентных штаммов (SF-АR - первый этап и SF – Вр2 - второй этап).

Специфичность продукта ПЦР (SF – Вр2) и (SF – К10R) размером 236 п.н. и 926 п.н. установлена с помощью рестрикции и прямого определения их последовательностей (рис. 5 а, б) (результаты анализа фрагмента 926 п.н. не представлены). Последовательность фрагмента 236 п.н. полностью совпадает с расчётной и состоит из двух частей, разделенных cсtagg сайтом. Слева от cсtagg сайта расположена последовательность оперона bvgAS (Х58355), справа – последовательность RSBP (S66929).

Для проверки зависимости частоты перемещения RSBP от состояния оперона bvgAS выполнены эксперименты по идентификации событий перемещения RSBP в бактериях B.pertussis IV фазы, содержащих полноценный оперон bvgAS в транс-положении на плазмиде pRV01. Клетки KmR B.pertussis IV фазы, содержащие нативный оперон bvgAS в транс-положении, отобраны в результате трансформации бактерий B.pertussis IV фазы плазмидой pRV01 (B.pertussis IVК). Определение видоспецифических агглютиногенов и ЛСА коклюшного токсина бактерий B.pertussis IV и B.pertussis IVК указывали на восстановление Bvg+ фенотипа в бактериях B.pertussis IVК. Результаты электрофореза продуктов ПЦР ДНК B.pertussis IVК, представленные на рисунке 6 (дор. 7, 14), показывают, что комплементация мутантного оперона bvgAS в транс-положении восстанавливает способность к перемещению RSBP в клетках B.pertussis.

Таким образом, нами разработана система регистрации событий транспозиции RSBP в сctagg сайт оперона bvgAS B.pertussis. События перемещения RSBP в бактериях B.pertussis наблюдаются только при наличии интактного оперона bvgAS. В возбудителе, хромосома которого содержит мутантный оперон bvgAS, события перемещения RSBP не регистрируются. Способность к перемещению RSBP восстанавливается в результате комплементации мутантного оперона bvgAS в транс-положении.

2.2.2. Перемещение RSBP в оперон bvgAS B.pertussis зависит от присутствия MgSO4 в среде культивирования бактерий.

Представленные в предыдущем разделе экспериментальные результаты позволяют охарактеризовать перемещение RSBP в клетках B.pertussis как bvg -регулируемый процесс. В таком случае, по аналогии с другими bvg- регулируемыми характеристиками бактерий Bordetella, такими как токсичность, гемаглютинирующая активность и т.д. (см. выше), перемещение RSBP может зависеть от модулирующих факторов (MgSO4 и никотиновой кислоты). Для проверки такого предположения нами отобраны отдельные бактериальные колонии B.pertussis Tohama I, выращенные на среде КУА. Каждую их этих колоний трижды пересевали на среде КУА и КУА+ MgSO4. Для анализа использовали также KmR трансформанты B.pertussis IVK, отобранные на среде КУА и КУА+ MgSO4 и расчищенные на соответствующих питательных средах. Результаты ПЦР анализа ДНК выделенных из бактерий B.pertussis Tohama I и B.pertussis IVK, проведенного по описанной выше схеме, выявили инсерцию RSBP в опероне bvgAS в бактериях, выращенных на КУА+ MgSO4, и не обнаружили инсерции в хромосоме бактерий, выращенных на среде КУА без MgSO4. Нестед - ПЦР (праймеры SF-АR и SF–Вр2) ДНК бактерий, выращенных в немодулирующих условиях, идентифицировала искомые продукты, специфичность которых доказана с помощью рестрикции и определения нуклеотидной последовательности. Полученный результат указывает на увеличение частоты транспозиции RSBP при культивировании бактерий в присутствии MgSO4.

Для определения соотношения между количеством копий мутантных (содержащих инсерцию RSBP в ссtagg сайт оперона bvgAS) и не мутантных хромосом в препарате ДНК бактерий B.pertussis Tohama I, выращенных в модулирующих условиях, проведена ПЦР с праймерами SF-AR и SF-Bp2 серии 10-кратных разведений ДНК хромосомы, одного из охарактеризованных выше клонов. Положительный сигнал амплификации ДНК с праймеров SF- AR фиксируется вплоть до 7-го разведения матрицы (К1), тогда как продукт ПЦР с праймеров SF-Bp2 только до 3-4-го разведения (К2). Зная, что специфический фрагмент 731 п.н. (SF-AR), должен формироваться при участии каждой копии хромосомной ДНК, тогда как фрагмент 236 п.н. (SF-Bp2) формируется только на ДНК, содержащих инсерцию RSBP, соотношение К2/К1 = 10-3-10-4 можно использовать в качестве оценки относительного количества молекул ДНК хромосом, содержащих инсерцию RSBP в cctagg последовательность оперона bvgAS, или частоты перемещения RSBP в cctagg сайт оперона bvgAS. Значения, полученные в аналогичных экспериментах для бактерий B.pertussis 5 и 35, составили около 10-2-10-3.

Таким образом, установлено, что в процессе размножения клеток вирулентных бактерий B.pertussis in vitro, наблюдается внутрихромосомное сайтспецифическое перемещение RSBP, сопровождающееся инактивацией оперона bvgAS возбудителя коклюша и переходом бактерий в авирулентное состояние. Авирулентные bvg- мутанты B.pertussis не способны поддерживать внутримолекулярное перемещение RSBP. Присутствие MgSO4 в среде культивирования повышает частоту перемещения RSBP.

Выявленная нами зависимость транспозиции от функционирования генов оперона bvgAS возбудителя коклюша и MgSO4 позволяют провести некоторые аналогии с регуляцией транскрипции гена bipA, экспрессирующегося в промежуточной фазе микроорганизмов рода Bordetella (Williams CI et al., 2005). Можно предположить, что регуляция транспозиции RSBP в бактериях B.pertussis осуществляется на уровне регуляции транскрипции его транспозазы за счет изменения концентрации фосфорелированного регулятора транскрипции BvgА. При больших концентрациях BvgА транскрипция ORF1 подавляется, при малых усиливается. Регуляция транскрипции может происходить в результате взаимодействия фосфорилированного белка BvgА с РНК-полимеразой и специфическими участками RSBP. Полное подавление синтеза белка BvgА в результате мутации в опероне bvgAS нарушает не только репрессию, но и активацию транскрипции транспозазы. Предлагаемая схема регуляции транскрипции транспозазы RS-элементов B.pertussis объясняет существующие экспериментальные результаты и выглядит привлекательной для понимания механизма сдерживания транспозиций множественно повторяющихся IS-элементов в хромосоме B.pertussis. Дополнительным фактором, работающим на понижение уровня активации транскрипции многократно повторенных копий гена транспозазы, может служить отсутствие в структуре RSBP канонических последовательностей для связывания BvgА с зоной и активации транскрипции bvg - регулируемых генов. Последовательность RSBP, расположенная выше стартового кодона ORF1, содержит только одну вырожденную последовательность ATTCAAT, похожую на консенсус T/A)TT(C/T)TA. Вырожденность предполагаемого участка связывания может привести к снижению аффинитета и уменьшению константы связывания BvgА, по крайней мере с участком, необходимым для активации промотора.

2.2.3. Выделение IS индуцируемых фазовых вариантов B.pertussis.

В настоящее время практически отсутствует информация о природе упомянутых выше авирулентных или частично вирулентных мутантов B.pertussis, выделенных от больных детей на разных стадиях заболевания или in vitro. Исключение составляют, упомянутые выше спонтанные авирулентный мутант оперона bvgAS B.pertussis и B.bronchiseptica, отобранные in vitro (Stibitz S, 1989, Monack DM, 1989 и McGillivray DM, 1989).

Изложенные в настоящей работе результаты позволили сформулировать подход к выделению и анализу мутантов B.pertussis, возникших в результате инсерции RSBP в гены, кодирующие факторы вирулентности возбудителя коклюша в процессе культивирования бактерий in vitro.

Для выделения бактерий, содержащих инсерцию RSBP в оперон bvgAS, культуру вирулентного штамма B.pertussis 5, пересевали на среде КУА + MgSO4 и рассевали до отдельных колоний на среду БЖ, содержащую 10% дефибринированной крови барана. Колонии, лишенные зон гемолиза, могут возникать в результате мутаций в опероне bvgAS или в генах гемолизинов. Среди 700 проанализированных колоний выявлено 10, не содержащих зон гемолиза. Бактерий, лишенные гемолитической активности, протестированы на присутствие активности термолабильного токсина на наличие факторспецифических агглютиногенов («Материлы и методы»). Все проверенные мутанты лишены активности ТЛТ и агглютиногенов 1,2,3. Так как экспрессия генов агглютиногенов, гемолизинов и ТЛТ регулируются с помощью оперона bvgAS (см. выше), можно ожидать, что отобранные клоны содержат мутацию в опероне bvgAS. ДНК из 5 проверенных бактериальных колоний проанализирована с помощью ПЦР. Электрофорез и определение нуклеотидной последовательность двух продуктов ПЦР выявили инсерцию IS1002 и дупликацию специфической последовательности CctagG оперона bvgAS (рис 5в). Секвенированная нами последовательность IS1002, идентичная ранее определенной последовательности IS1002 (van der Zee, A. et al. 1996), имеет 60,5% гомологии с последовательностью RSBP(IS481) и содержит открытую рамку считывания ORF1, кодирующую транспозазоподобный белок tnpA размером 214 аминокислот. Первые 130 аминокислот tnpA IS1002 на 58% идентичны соответствующему фрагменту транспозазы RSBP и содержат в себе характерный ДНК–cвязывающий мотив. В структуре tnpA IS1002 нет ярко-выраженного каталитического DDE-домена, характерного для транспозазы RSBP и большинства известных транспозаз бактерий, что само по себе не означает отсутствие необходимой каталитической активности у белка tnpA IS1002. Наличие шести консервативных копий IS1002 в геноме B.pertussis указывает на значимость её последовательности для кодирования белков транспозиции. Возможно, транспозицию IS1002 обеспечивает ДНК-связывающий домен tnpA IS1002 и DDE-домен транспозазы RSBP(IS481) или только транспозаза RSBP. Идентичность концевых нуклеотидов и значительное сходство инвертированных терминальных повторов IS1002 и IS481 (80%), могут свидетельствовать в пользу такого предположения.

Таким образом, нами установлено, что перемещение RSBP(IS481) и IS1002, наблюдаемое в бактериях B.pertussis, содержащих интактный оперон bvgАS, может привести к инактивации оперона bvgAS возбудителя коклюша. Выделены мутантные клоны бактерий B.pertussis 5, хромосома которых содержит инсерцию IS1002 в cctagg сайте оперона bvgAS.

2.2.4. Оперон bvgAS влияет на транспозицию RSBP в Pts мутантах E.coli.

Как следует из материала изложенного в предыдущих главах, оперону bvgAS и IS-элементам принадлежит важная роль в регуляции вирулентности и изменчивости возбудителя коклюша. Регуляция экспрессии bvg–зависимых генов, число которых постоянно возрастает по мере накопления информации о возбудителе, осуществляется на уровне регуляции их транскрипции. Регулятор транскрипции BvgA связывается с операторами промоторной зоны регулируемого гена. Белок BvgS – АТФ-зависимая фосфокиназа, фосфорилирует белок BvgА, сообщая ему возможность специфического связывания с операторной областью гена и РНК полимеразой (Cotter PA, Miller JF., 2001). Нами установлено, что в клетках E.coli и B.pertussis события RS-индуцированной рекомбинации зависят от функционирования ФТС и bvgАS, соответственно. Несмотря на значительные отличия в функционировании и назначении ФТС и двухкомпонентной регуляторной системы BvgАS в клетках E.coli и B.pertussis, они имеют ряд общих характеристик. Ключевым этапом их работы является передача фосфата на белки-мишени, которые в свою очередь, участвуют в обеспечении транспорта углеводов (в E.coli) и регуляции экспрессии большой группы бактериальных генов (E.coli и B.pertussis) (Гершанович ВН 2003, 2004, Cotter PA, Miller JF, 2001). Участие компонентов ФТС в событиях RS-индуцированной рекомбинации в бактериях E.coli и сходство некоторых характеристик ФТС и двухкомпонентной регуляторной системы BvgАS, позволили предположить, что экспрессия оперона bvgАS в Pts- мутантах E.coli может привести к восстановлению транспозиции RS-элементов в мутантных бактериях E.coli.

Для изучения RS-индуцируемой интеграции использованы произодные плазмиды рМТ2, не способные реплицироваться в бактериях E.coli при температуре выше 350С и содержащие маркер устойчивости к Km (Greated A, 2000). Рекомбинантные лазмиды включали в себя сконструированные нами варианты TnВР, маркированные генами устойчивости к Cm (TnBP-Cm) и Тс (TnBP-Тс). Интеграцию плазмид рМТ::TnBP-Cm и рМТ::TnBP-Тс в хромосому E.coli изучали на изогенных бактериях E.coli дикого типа LBG1623, KmR мутанте PtsI LBG1623-I3 и СmR мутанте PtsH LBG1623-H7, содержащих плазмиды рМТ::TnBP-Cm, рМТ::TnBP-Tc и рМТ2. События интеграции регистрировали по появлению СmR или TcR клонов бактерий, после культивирования на селективном L–агаре при температуре 420С (в дальнейшем TR клоны) по схеме, аналогичной использованной нами ранее. Частоту интеграции определяли, как и раньше, по отношению числа TR бесплазмидных клонов к числу взятых в эксперимент живых бактерий. Некоторые TRСmR или TRTcR бесплазмидные клоны проверяли на наличие гена kan плазмиды рМТ2 (ген устойчивости к канамицину в составе хромосомы PtsI LBG1623-I3 отличается от гена kan плазмиды рМТ2) и последовательности RSBP с помощью ПЦР. Все они содержат искомые последовательности, что свидетельствовало об интеграции плазмид рМТ::TnBP-Cm и рМТ::TnBP-Tc в хромосому рекомбинантов. Результаты экспериментов представлены в таблице 7.

Таблица 7. Значение частот «спасения маркеров» в бактериях E.coli

Штамм Генотип Плазмида Частота
LBG1623-2 PtsH +, KmR pMT2 >10-8
LBG1623-2TC PtsH +, KmR CmR pMT2::TnBP- Cm 2,5х10-3
LBG1623-I32TC PtsI, KmR CmR рМТ2 ::TnBP- Cm 2,5х10-4
LBG1623-H72T PtsH7, KmR TcR рМТ2::TnBP- Tc 1,3х10-6
LBG1623-I32V PtsI+, KmR CmRApR рМТ2 ::TnBP- Cm +pDM20 2х10-3
LBG1623-H72V PtsH7+, KmR TcRApR рМТ2::TnBP- Tc + pDM20 1,1х10-2

Из таблицы видно, что мутация PtsH7 привела к выраженному снижению частоты интеграции плазмиды рМТ::TnBP-Тс, в сравнении с Pts+ бактериями. Примерно такое же снижение частоты интеграции плазмиды рКК3 наблюдалось в точечном мутанте PtsH5 LBG1605 по сравнению со штаммом дикого типа LBG1623, что вполне ожидаемо, так как обе мутации затрагивают ген ptsH и отличаются только типом мутации. Если хромосома PtsH5 LBG1605 содержит две точечные мутации в гене ptsH (Большакова Т.Н., личное сообщение), то мутация PtsH7 LBG1623 представляет собой делецию части последовательности гена ptsH и инсерцию гена cad (см. «Материалы и методы). Инсерционная мутация в гене ptsI (Datsenko K, личное сообщение), кодирующем фермент I, приводит к менее значительным снижениям частот интеграции. Вероятно, это связано с тем, что мутация PtsH7 нарушает транскрипцию всего оперона pts, тогда как инсерция в ген ptsI, только структуру и экспрессию гена ptsI.

Внесение оперона bvgAS в Рts мутанты бактерий E.coli, в составе плазмиды рDM20 (Karimova G. Pasteur Inst., France), восстанавливает их способность к поддержанию RSBP-индуцированной интеграции рекомбинантных плазмид в хромосому. Частота RSBP-индуцированной интеграция рМТ::TnBP-Cm в мутанте Рts I в присутствии плазмиды рDM20 возросла до значений, определенных для штамма дикого типа, а в мутанте PtsH7/рDM20 частота интеграции даже превзошла соответствующее значение для штамма дикого типа.

Представленные экспериментальные результаты укладываются в сформулированную ранее гипотезу о регуляции транскрипции гена транспозазы с помощью белков ФТС и BvgАS. Можно предположить, что ФТС обеспечивает фосфорилирование некоего регуляторного белка E.coli, участвующего в транскрипции транспозазы. В Pts мутантах E.coli фосфорилирование регулятора нарушается, а транскрипция транспозазы снижается, что проявляется в снижении частот наблюдаемых RS-индуцируемых рекомбинационных событий. В Pts мутантах E.coli, содержащих оперон bvgAS в транс-положении, фосфорилированный белок BvgА обеспечивает транскрипцию гена транспозазы, заменяя, по-видимому, фосфорилированный регулятор транскрипции, функционирующий в бактериях дикого типа, и не активный в Pts мутантах E.coli.

Таким образом, мутации по генам ptsI и ptsH в разной степени снижают частоты RSBP-индуцируемых интеграции плазмид в хромосому E.coli. Способность к интеграции восстанавливается в мутантах, содержащих оперон bvgAS в транс–положении.

2.2.5. Биологическое значение событий инсерционой инактивации оперона bvgAS в бактериях B.pertussis. Новый подход к регистрации фазовой изменчивости возбудителя коклюша in vitro и in vivo.

Коклюш - острое, респираторное инфекционное заболевание, с высокой летальностью у детей первого года жизни. Предполагается, что вспышки коклюша у восприимчивых к возбудителю новорожденных обусловлены носительством (персистенцией) бактерий B.pertussis у детей старшего возраста и взрослых, являющихся источником инфекции. Обследования длительно кашляющих взрослых и подростков выявили от 12% до 52% носителей возбудителя коклюша (Matttoo S, Chery JM, 2005).

Совместно со специалистами «Консультативно - диагностической поликлиники Медицинского центра Управления делами Президента Российской Федерации» проведены обследования детей с симптомами коклюша и острых респираторных инфекций (ОРЗ). Выявление возбудителя проводили методом дотт-гибридизации нерадиоактивного зонда, представлявшего собой ДНК RSBP, с ДНК, выделенной из смывов с назофарингеальных мазков от детей разных возрастных групп. Контролем служили традиционные исследования – бактериологический анализ посевов, клинические обследования и серологические исследования крови для выявления антител к возбудителю коклюша аденовирусов, энтеровирусы, вирусы гриппа А и В, парагриппа 1, 2, 3, выполненные в лаборатории Медицинского центра Управления делами Президента Российской Федерации в соответствии с действующими инструкциями.

Аналогичные исследования проведены совместно со специалистами ЗАО НПО «Лагис» с использованием метода ПЦР. Обследования проводили в детских садах (№ 213 и 272) и поликлиниках (№ 103, 111, 63, 81 и 97) Юго-Западного округа. Кроме того, методом ПЦР обследовано 89 детей (52 ребенка с длительным кашлем и 37 практически здоровых ребенка), обратившихся за консультативной помощью к сотрудникам группы молекулярной биологии патогенных микроорганизмов ГУ НИИЭМ им. Н.Ф. Гамалей РАМН в 1998- 2006гг. Результаты обследования представлены в таблице 8.

Таблица 8. Результаты исследования смывов назофарингеальных мазков от детей с помощью метода ДНК гибридизации (ДНК Г, 1-й эксперимент) и ПЦР (2-ой эксперимент).

Состояние обследован-ных детей Количество обследованных Количество детей с лабораторно подтвер-жденным диагнозом Количество положительных результатов обследования
1 2* 1 2* ДНК Г ПЦР*
Коклюш 69 - 24 (40%) - 56 (81%) -
ОРВИ 54 38 (70%) - 20 (37%) -
Здоровые дети 58 82 - - 5 (8,6%) 6 (7,3%)
Длительный кашель - 106 - - - 31 (30%)
Всего 181 188

* объединены все исследования с помощью метода ПЦР.

Из таблицы 8 видно, что в группе детей с клиническим диагнозом коклюш, методом ДНК-гибридизации возбудитель выявлен в 81% случаев, в сравнении с 40% случаев, зарегистрированных с помощью бактериологического метода. Положительная реакция ДНК- гибридизации, обнаружена при обследовании 37% детей с диагнозом ОРЗ, что, скорее всего, указывает на смешанную вирусную и коклюшную инфекцию. 82 длительно кашляющих ребенка и 106 «практически здоровых» детей обследованы с помощью разработанной нами ПЦР тест-системы (см. ниже). ДНК возбудителя коклюша обнаружена в назофарингеальных мазках у 31% и 7,3% длительно кашляющих и здоровых детей, соответственно, что совпадает с результатами зарегистрированным нами с помощью метода ДНК-гибридизации. Heininger U et al., 2004 выявили ДНК B.pertussis у 5,3% пациентов контрольной группы, не имеющих симптомов коклюша в момент обследования. Обнаруженные отличия в цифрах нельзя считать значимыми из-за малого числа выявленных положительных результатов. Присутствие ДНК B.pertussis у практически здоровых людей может указывать на бактерионосительство или быть связано с начальной стадией или атипичной формой коклюша, по крайней мере, у некоторых из обследованных пациентов. Из представленных в таблице результатов следует также, что разработанная нами тест-система для выделения ДНК B.pertussis методом ПЦР обнаружила возбудитель коклюша более чем у 30% длительно кашляющих детей.

Таким образом, коклюш может проявляться в стертой форме и протекать под маской ОРЗ у детей и взрослых с длительным кашлем. (5-7)% практически здоровых и более 30% длительно кашляющих детей являются носителями возбудителя коклюша. Носители могут быть источниками заражения не иммунизированных детей и взрослых, прежде всего иммунодефицитных людей.

Механизмы перехода бактерий в состояние носительства не установлены. Предполагается, что носительство формируется в результате переживания бактерий внутри эукариотических клеток, длительность которого зависит от состояния вирулентности бактерий. Нами показано, что регуляция генов вирулентности B.pertussis может быть нарушена в результате инсерции IS-элементов в оперон bvgAS. Частота перемещения IS-элементов в оперон bvgAS и другие специфические сайты хромосомы B.pertussis in vitro, зависит от условий культивирования возбудителя и функционирования оперона bvgAS. Результаты ряда исследователей, указывают на увеличение времени переживания в эукариотических клетках бактерий B.pertussis, мутантных по генам аденилатциклазы (Gueirard P, 1998). Это позволяет предположить, что инактивация в результате инсерции IS-элементов в оперон bvgAS или других генов вирулентности, может быть пусковым механизмом перехода бактерий в состояние переживания или персистенции. Так как на первом этапе взаимодействия происходит адгезия бактерии к эукариотической клетке, то изменение её фазового состояния, способствующее переживанию, скорее всего, происходит после проникновения бактерии в клетку хозяина. Точное исключение IS-элемента, восстанавливающее экспрессию гена(ов) вирулентности, может привести к апоптозу, гибели эукариотической клетки, освобождению вирулентной бактерии и развитию инфекционного процесса в организме-хозяине или передачи возбудителя новому реципиенту. Альтернативой внутриклеточному переживанию, может быть переживание бактерий в биоплёнках, возможность формирования которых установлена для бактерий B.bronchiseptica, находящихся в промежуточной фазе Bvgi (Mattoo MH, Yuk К, 2004). Механизмы перехода бактерий в промежуточную фазу in vivo не установлены, что не позволяет исключить участие в этом процессе IS-элементов Bordetella. Увеличение частоты транспозиции IS-элементов может быть индуцировано факторами организма-хозяина, попаданием бактерии во внешнюю среду или воздействием других факторов, связанных, например, с применением средств лекарственной терапии заболевания.

Полученные результаты позволяют разработать методы регистрации не только инсерционных Bvg- мутантов B.pertussis, но и бактерий, содержащих инсерцию IS-элемента в гены, кодирующие различные факторы вирулентности возбудителя коклюша (КТ, ФГА, и т.д), и открывают новые возможности для исследования фазовых состояния бактерий B.pertussis в клиническом материале на разных стадиях заболевания. Информация о структуре генов вирулентности in vivo позволит установить значение кодируемых ими продуктов для развития инфекции и перехода бактерий в состояние переживания (персистенции).

2.3. Выделение и характеристика новых бактериофагов и определение лизогенности микроорганизмов рода Bordetella.

Результаты, изложенные в предыдущих разделах, подтверждают значимость IS элементов в изменчивости и регуляции вирулентности возбудителя коклюша. К МГЭ относятся и умеренные бактериофаги. Лизогенизация бактерий может привести к изменениям их свойств, в том числе и вирулентности. Изменение вирулентности достигается в результате прямого переноса факторов патогенности, например генов токсинов, или является следствием более сложных событий, изменяющих поверхностные антигены бактериальной клетки (Hendrix RW, 1999).

В настоящее время охарактеризованы бактериофаги микроорганизмов рода Bordetella, выделенные в НИИЭМ им. Н.Ф.Гамалеи из бактерий коллекции ВОЗ и клинических штаммов, бактериофагами BPP-1, BMP-1 и BIP-1 B.bronchiseptica, проявляющие различный тропизм к бактериям в разных фазовых состояниях (Liu M. et.al., 2004), и два бактериофагами B.avium В1 и В2, способные к генерализованной трансдукции (Shelton C.B., et al., 2000).

В работе описаны новые бактериофаги Т и К, изолированные из международного штамма вирулентных бактерий B.pertussis Tohama I, и бактерий 662-2, полученных в результате конверсии бактерий B.parapertussis 17903 бактериофагом B.pertussis 134. Проведен сравнительный анализ структуры геномов бактериофагов Т и К и ранее изолированных бактериофагов 134 и 41405 - B.pertussis и 214 -B.bronchiseptica. Выявлены особенности лизогении и конверсии бактерий рода Bordetella.

Бактериофаги Т и К морфологически идентичны друг другу и ранее охарактеризованным фагам B.pertussis 134, 41405 и 214 B.bronchiseptica. Диаметр икосаэдрической головки составляет (49,5±0,5)нм. Бактериофаги имеют хвостовой отросток длиной (145±7) н.м., толщиной (8,7±0,8) н.м. с внутренним каналом (2,0 ±0,2)нм. Хвостовой отросток представлен, соединенными друг с другом 37-40 сегментами, на которые он легко фрагментируется. Сегменты имеют розеткообразную структуру диаметром (11,0±1,0)нм. Розетки образованы 6-7 субъединицами и соединены с соседними розетками на расстоянии порядка 15 нм друг от друга.

Результаты электронно-микроскопического анализа ДНК бактериофагов B.pertussis 134, 41405, Т и B. bronchisepticа 214. показали, что их популяции гетерогенны и содержат гомологичные ДНК размером (37 ±2)т.п.н., отличающиеся друг от друга одной или двумя инсерциями размером около 1 т.п.н. Геном бактериофага К размером (41± 3)т.п.н. циркулярно пермутирован, так же как и геномы бактериофагов BPP-1, BMP-1 и BIP-1, и не гомологичен ДНК других фагов. Пермутированность генома К указывает на его способность к генерализованной трансдукции.

Саузерн-гибридизация ДНК бактериофагов Т, 134 с хромосомами бактерий-хозяев и других бактерий рода Bordetella, а также ДНКК с хромосомами разных штаммов B.parapertussis не обнаружила фаговых геномов в структуре хромосом, что указывает на преимущественно внехромосомную локализацию геномов Т, 134, 41405, 214 во всех изученных бактериях Bordetella и К в бактериях B.parapertussis. В пользу такого предположения говорят результаты дотт-гибридизации, обнаружившей 1 на 500-700 отдельных колоний бактерий-хозяев, содержащих ДНК бактериофагов, и анализа последовательности участка ДНК, являющейся сайтом интегрирации генома профага ВPP1 в хромосому B.bronchiseptica RB50. Сопоставление последовательностей (Liu M., Gingery M., Doulatov S.R. et.al., 2004) и B.bronchiseptica RB50 (EMBL BX470250) не выявило профага ВPP1 в хромосоме. Таким образом, два разных коллектива авторов, определяя последовательность ВPP1 в хромосоме B.bronchiseptica RB50, получили принципиально разные результаты в участке интеграции профага. С нашей точки зрения, эти результаты можно объяснить только тем, что авторы имели дело с разными клонами возбудителя, один из которых оказался лизогенным. Можно ожидать, что выделение такого лизогенного клона является достаточно редким событием как для штамма B.bronchiseptica RB50, так и для штаммов B.pertussis 134, Tohama I, B.bronchiseptica 214 и B.parapertussis 17903. Низкая степень лизогенизации бактерий рода Bordetella может быть связана с потерей фагового генома, находящегося, скорее всего, в состоянии линейной плазмиды.

Саузерн-гибридизация Р32 меченной ДНК бактериофага 134 B.pertussis выявила гибридизацию только с одним фрагментом Pst1 рестрикции ДНК хромосом конвертантов B.parapertussis 662-2 (рис.7а). Размер фрагмента (около 7 т.п.н.) указывает на то, что только часть фагового генома интегрирует в хромосому бактерии в процессе лизогенизации. Бактерии конвертантов, резистентные к фагу 134, приобрели специфические агглютиногены, летальную токсичность, способность размножаться в мозговой ткани мышей и так далее, характерные для вирулентных бактерий B.pertussis (Лапаева И.А. и др. 1982). Можно предположить, что в процессе лизогенизации клеток конвертанта принимают участие IS-элементы бактерий Bordetella. Возможно, фрагмент генома фага 134, фланкированный IS-элементами, перемещается в хромосому B.parapertussis, тогда как основная часть генома остается в свободном состоянии и утрачивается популяцией бактериальных клеток. Каким образом, перемещение небольшого фрагмента фаговой ДНК в хромосому B.parapertussis приводит к значительным изменениям свойств возбудителя паракоклюша, предстоит выяснить.

Результаты Саузерн - гибридизации ДНК хромосом B.parapertussis 17903 и 594; двух независимых конвертантов 662-2,; авирулентного мутанта B.pertussis IV и вирулентных бактерий B.pertussis 134, Tohama I, 3865; а также бактерий B.bronchiceptica 8220, W, 3K, выделенных от свиней в хозяйствах СССР, c меченой P32ДНК фага К представлены на рисунке 7б.

Рисунок 7. Саузерн-гибридизация Р32 ДНК бактериофага 134 (а) и Р32 ДНК К1 (б) с хромосомами бактерий рода Bordetella.

а) PstI фрагменты рестрикции B.parapertussis 17903, B.pertussis 134 (дор.1 и 2), B.parapertussis 662-2(1), 662-2(2) и 662-2(2) при двойной дозе фермента (дор.3, 4 и 5). Маркер (дор. 6): 23,7; 9,5; 6,7; 4,3 т.п.н..

б) EcoRI фрагменты рестрикции ДНК бактериофага К1 (дорожка 1) и хромосом B.parapertussis 662-2(1) и 662-2(2) (дор. 2 и 3), B. parapertussis 504 (дор. 4), 17903 (ДНК дор. 5, 11 и 13), B.bronchiceptica 214, W, 3K (дор. 6-8), 8220 (дор. 9 и 10), B.pertussis IV (дор.12), 134(дор.14), Tohama I (дор.15), 3865 (дор. 16).

б) а)

1 2 3 4 5 6

Сравнение профилей гибридизации фрагментов EcoR1 рестрикции ДНК хромосом различных видов бактерий рода Bordetell с ДНК К, представленных на рисунке 7б (дор. 2-16), позволяет сделать следующие заключения:

- ДНК К гибридизуется с ДНК хромосом всех исследованных возбудителей рода Bordetella кроме B.parapertussis;

- картины гибридизации ДНК хромосом B.bronchice ptica 214, W, 3K (дор. 6-8) близки к картине гибридизации ДНК 662-2 (дор. 2,3), что указывает на одинаковую локализацию генома профага в хромосомах бактерий;

- характер изменения картины гибридизации ДНК хромосом независимых клонов B.bronchiceptica 8220 (дор. 9, 10) по отношению к гибридизации ДНК 662-2 указывает на одинаковую локализацию геномов профагов и на наличие мутаций в структуре профага B.bronchiceptica 8220;.

- картина гибридизации ДНК хромосомы B.pertussis 3865 (дор. 16) указывает на то, что геномы профагов 3865, W, 3K, 214 и 662-2 не идентичны, хотя и имеют протяженные участки гомологии, локализованные, скорее всего, в различных участках хромосомы бактерий;

- характер гибридизации ДНК хромосом B.pertussis 134 и Tohama I (дор. 14 и 15) свидетельствует о значительных отличиях геномов профагов этих штаммов бактерий от профагов B.bronchiceptica 8220, W, 3K, 214, B.pertussis 3865 и конвертанта 662-2;

- выявлено значительное отличие между картинами гибридизации ДНК хромосом B. pertussis IV, 134, Tohama I. Профиль саузерн-гибридизации фрагментов хромосомы авирулентного штамма B. pertussis IV (дор. 12) ближе к гибридизации хромосомы B.bronchiceptica 8220 (дор. 9,10), чем к профилю гибридизации вирулентных штаммов B. pertussis Tohama I или 134 (дор.14, 15).

Результаты, полученные при изучении выделенных нами и охарактеризованных ранее бактериофагов и лизогенности бактерий рода Bordetella, позволяют сделать следующие выводы:

- бактерии, по крайней мере, двух представителей рода Bordetella - B.pertussis и B.bronchiseptica полилизогенны. Геном одного из двух идентифицированных профагов находится в составе хромосомы клеток-хозяев. Второй профаг, скорее всего, находится в автономном состоянии и утрачивается значительной долей популяции бактерий при культивировании in vitro;

- бактериофаг B.pertussis 134 способен осуществлять лизогенизацию бактерий B.parapertussis 17903, сообщая им ряд свойств возбудителя коклюша. В процессе конверсии происходит интеграция части фагового генома 134 в хромосому конвертанта, возможно в результате IS- индуцированной рекомбинации фрагмента фагового генома и хромосомы B. parapertussis 17903;

- бактерии конвертанта B.parapertussis 17903 продуцируют бактериофаг К, последовательность которого отсутствует в хромосоме B.parapertussis 17903. Бактериофаг К идентичен по морфологии с фагами Т, 134 и 214, но имеет совершенно отличный от них геном;

- последовательности, гомологичные ДНК бактериофага К, обнаружены в хромосоме двух независимых конвертантов B.parapertussis 17903 и всех изученных нами штаммах бактерий B.pertussis и B.bronchiseptica. Локализация сайтов интеграции геномов профагов, гомологичных К, различна у разных видов и штаммов бактерий и может быть связана с вирулентностью бактерий;

- свойства бактериофагов микроорганизмов рода Bordetella указывают на их принадлежность к классу МГЭ.

2.4. Конструирование тест-систем для идентификации ДНК возбудителя коклюша и его фазовых вариантов с помощью полимеразной цепной реакции (ПЦР).

Сложность лабораторной диагностики коклюша, распространенность возбудителя среди «практически здоровых» и длительно кашляющих людей различных возрастных групп делают актуальным разработку тест-систем, пригодных для идентификации возбудителя коклюша и его фазовых состояний.

Целью настоящего раздела работы является создание тест-системы, содержащей внутренний стандарт (ВС), обеспечивающей высокое качество анализа клинических образцов с помощь ПЦР, и пригодной для транспортировки при комнатной температуре.

Согласно современным представлениям, таким требованиям удовлетворяет тест-системы, содержащие высушенные в «ПЦР-пробирке» компоненты реакционной смеси, в том числе и ДНК ВС, и обеспечивающие «технологию горячего старта» ПЦР. В разработанной нами тест–системе «горячий старт» достигается в результате временной инактивации Taq – полимеразы за счёт её взаимодействия с моноклональными антителами (МАТ). Тест-система состоит из сухих компонентов, включающих праймеры K10f - K10r, комплекс Taq – полимеразы и МАТ, смеси трифосфатов и ДНК ВС, помещенных в реакционную пробирку объемом 0,6 мл. ПЦР проводится в пробирке после добавления в нее ПЦР-буфера и исследуемой ДНК. Комплекс Taq – полимеразы с МАТ денатурируется в результате прогрева пробирки при 950С в течение 5 минут. Для предотвращения ложноотрицательных результатов, разработан внутренний стандарт ПЦР (ВС). ВС - плазмидная ДНК, состоящую из вектора pGEM и клонированного фрагмента ДНК B.pertussis Tohama I. Клонированный фрагмент включает в себя последовательность хромосомы B.pertussis Tohama I, содержащую вставку ДНК бактериофага размером около 200 п.н., фланкированную праймерами K10f-K10r. Использование ВС позволяет, не только контролировать качество реакции, но и оценить количество ДНК мишени в образце. Для детектирования продуктов реакции может быть использован гельэлектрофорез или один из вариантов методов гибридизации.

Для выделения ДНК из смывов с назофарингеальных тампонов использована обработка клинического материала раствором гуанидинтиоционата с последующей сорбцией ДНК на магнитном сорбенте фирмы Promega США.

Модельные эксперименты по определению чувствительности сконструированной нами тест-системы, выполненные на серии разведений суспензии бактерий B.pertussis Tohama I и очищенной бактериальной ДНК, показали, что она составляет 5-10 бактерий в реакции.

Для определения специфичности тест-системы использованы ДНК в количестве 107-108 геном эквивалентов на реакцию, выделенные их различных микроорганизмов, находящихся в коллекциях НИИЭМ им. Н.Ф. Гамалеи РАМН и контрольного института ГУ НИИГИСК им. Л.А. Тарасевича: HBV, HSV, CMV, Chl.trachomatis, Chl.pneumonia, M.hominis, U.urealyticum, G.vaginalis, T.vaginalis, Streptoccocus B,D,G, F, M.tuberculosis, E.coliK12, B.pertussis, B.pаrаpertussis, B.bronchiseptica, L.pneumophilia, K.pneumoniae, C.diphtheriae, S.typhi, Sh.sonnei, Sh.flexneri, Y.pseudotuberculosis, Enteropathogenic и ДНК человека.

Специфический сигнал амплификации зарегистрирован с помощью электрофореза в агарозном геле только при использовании в качестве матрицы ДНК B.pertussis, B.pаrаpertussis и B.bronchiseptica. Тест-система выявляет ДНК бактерий B.parapertussis и B. bronchiseptica в количестве более чем 1000 молекул в реакции, что более чем в 100 раз хуже, чем чувствительность при выявлении ДНК B.pertussis и соответствует примерно 105 бактерий/мл суспензии. Схожие результаты были получены с помощью использованного нами метода ДНК-гибридизации. Низкая чувствительность метода при выявлении ДНК B.parapertussis и B. bronchiseptica, делает возможным использование разработанной нами тест-системы для видоспецифической диагностики возбудителя коклюша в клинических образцах.

Однако, как показывают приведенные выше результаты, при использовании больших концентраций ДНК, существует возможность идентификации бактерий B.parapertussis и B.bronchiseptica в ПЦР с праймерами K10f - K10r. ПЦР анализ ДНК 40 штаммов B.bronchiseptica, выделенных от животных и находящихся в коллекции НИИЭМ им Н.Ф.Гамалеи, показал, что бактерии 21 штамма содержат, последовательности гомологичные RSBP B.pertussis. Эти результаты указывают, по-видимому, на более широкую распространенность штаммов B.bronchiseptica, содержащих последовательности гомологичные RSBP, чем это было выявлено Diavatopoulos D.A. et al., 2005. Это обстоятельство необходимо учитывать при видоспецифическом типировании культур бактерий рода Bordetella с помощью ПЦР.

Аналогичный принцип, основанный на использовании технологии «горячего старта» и иммобилизованной в ПЦР пробирках реакционной смеси положен в основу тест-системы для идентификации ДНК B.pertussis, содержащей инсерцию RSBP в специфическом сайте оперона bvgAS.

Таким образом, нами разработаны и проверены в лабораторных условиях тест-системы для выявления ДНК возбудителя коклюша и его Bvg- мутантов, содержащих инсерцию RSBP в опероне bvgAS, методом ПЦР. Тест-система для выявления ДНК возбудителя коклюша использована для диагностики атипичных и бессимптомных форм коклюша у детей и взрослых.

В Ы В О Д Ы

1. Хромосома B.pertussis содержит большое число повторяющихся нуклеотидных последовательностей (RS-элементов), имеющих различную ориентацию и образующих транспозоно-подобные структуры. Клонированы RS - элемент (RSВР) и Tn-подобная структура (TnBP) хромосомы B.pertussis 475; сконструированы их генетически маркированные варианты.

2. RSВР и TnBP B.pertussis обладают основными свойствами мобильных генетических элементов: перемещаются между плазмидой и хромосомой, индуцируют RecА независимое формирование коинтегратов между плазмидами и между плазмидой и хромосомой бактерий E.coli; индуцируют перестройки прилегающего генетического материала генома хозяина, что позволяет отнести их к классу инсерционных последовательностей (IS-элементов) и транспозонов.

3. Частота формирования RSВР-индуцируемых коинтегратов зависит от генотипа бактерий E.coli, прежде всего, от активности генов фосфоенолпируватзависимой фосфотрансферазной системы. Нарушение функционирования ФТС E.coli, снижает частоты формирования RSВР-индуцируемых коинтегратов и внутрихромосомного перемещения интегрированной структуры.

4. Определена открытая рамка считывания (ORF1), в составе RSВР, кодирующая транспозазу (белок р36). Сконструирован штамм E.coli, продуцирующий функционально активную транспозазу, основная масса которой находится в нерастворимой фракции бактерий штамма-продуцента.

5. Установлено, что перемещение RSBP в специфический сайт оперона bvgAS B.pertussis, регулирующего вирулентность возбудителя коклюша, зависит от функционирования оперона bvgAS: в бактериях B.pertussis, содержащих мутантный оперон bvgAS, перемещения RSBP не регистрируются; способность к перемещению восстанавливается при транс-комплементации мутантного оперона bvgAS. Формирование RSBP- индуцируемых коинтегратов восстанавливается в Pts- мутантах E.coli, содержащих оперон bvgAS в транс-положении.

6. Выделены спонтанные авирулентные Bvg- инсерционные мутанты B.pertussis, сформированные в результате перемещения RSBP в оперон bvgAS. Показано, что популяции бактерий всех изученных Bvg+ штаммов B.pertussis гетерогенны и содержат инсерционные Bvg- мутанты с частотой 10-4 – 10-2. Относительное число Bvg- бактерий в популяции зависит от штамма и условий культивирования. Частота перемещения RSBP увеличивается в присутствии MgSO4.

7. Формирование инсерционных Bvg- мутантов B.pertussis в результате перемещения RSBP в оперон bvgAS; зависимость частоты перемещения RSBP от функционирования оперона bvgAS и условий культивирования бактерий B.pertussi и способность RSBP индуцировать точное исключение интегрированных структур из хромосомы E.coli свидетельствуют об участии IS-элементов в регуляции экспрессии генов вирулентности возбудителя коклюша.

8. Сформулирована гипотеза, устанавливающая связь между образованием фазовых состояний и переживающих (персистирующих) форм возбудителя коклюша, с инактивацией генов вирулентности B.pertussis в результате инсерции IS-элементов. Исключение IS из сайта интеграции восстанавливает вирулентность и может привести к развитию заболевания.

9. Штаммы бактерий B.pertussis и B.bronchisepticа – полилизогенны. Последовательности, гомологичные ДНК бактериофага К, обнаружены в хромосомах всех изученных штаммов бактерий B.pertussis и B.bronchiseptica. Геном профага, гомологичного Т, локализован вне хромосомы и утрачивается в процессе культивирования большей частью популяции бактерий изученных штаммов бактерий рода Bordetella.

10. Различная локализация геномов одного из профагов в хромосомах разных видов и штаммов бактерий рода Bordetella, и способность второго исследованного бактериофага интегрировать часть генома в хромосому B.parapertussis, вызывая изменение свойств возбудителя паракоклюша, позволяют отнести выделенные бактериофаги к классу мобильных генетических элементов.

11. Разработаны тест–системы, с помощью которых показано, что до 30% детей с диагнозом ОРЗ и 5% - 7% практически здоровых детей инфицированы возбудителем коклюша. Разработаны тест-системы для регистрации событий перемещения RSBP в оперон bvgAS Bordetella.

Список работ, опубликованных по теме диссертации.

1. Гинцбург А.Л., Янишевский Н.В., Мотин В.Л. Каратаев Г.И., Смирнов Г.Б. Природа последовательностей RSI, фланкирующих ген vct, кодирующий синтез холерного токсина у Vibrio cholerae eltor.// Молек. генетика, микробиология и вирусология. -1986. -№2.-с.11- 17.

2. Покровская М.С., Каратаев Г.И., Смирнов Г.Б. Особенности образования и свойства плазмид pLS, возникающих в результате делеций генома бактериофага att80 (Tn9) //Мол. генетика, микробиология и вирусология.-1986.-№1.-с.12-18.

3. Покровская М.С., Каратаев Г.И., Смирнов Г.Б. Делеции генома фага att80::Tn9. Характкр внутримолекулярной рекомбинации.//Мол. генетика, микробиология и вирусология. -1986.-№10.-с.33-39.

4. Каратаев Г.И., Рябинина О.П., Лапаева И.А. Множественно повторяющиеся последовательности ДНК хромосомы - видовой признак B.perussis.// Сб. Вопросы физиологии, метаболизма и идентификации микроорганизмов.-Москва. 1987.-с.11-17.

5. Гольцмайер Т.А., Каратаев Г.И., Розинов М.Н., Москвина И.Л., Шумаков Ю.Л., Мотин В.Л., Мебель С.М., Гершанович В.Н., Лапаева И.А. Особенности лизогении и конверсии у микробов рода Bordetella // ЖМЭИ.-1987.-№ 5.-с.9-13.

6. Дорошенко В.Г., Данилевич В.Н., Каратаев Г.И., Лившиц В.А. Структурная и функциональная организация транспозона Tn2555, несущего гены утилизации сахарозы. Молекулярная биология.//-1988.-т.22.-с.645-658

7. Karataev G.I., Lapajeva I.A., Ryabinina O.P., Mebel S. Detection of a new bacteriophage in Bordetella.//FEMS- symposium Pertussis. Berlin, GDR.- 1988.-p.20.

8. Каратаев Г.И., Мотин В.Л., Рябинина О.Г., Лапаева И.А.. Электронно-микроскопическое изучение повторяющихся последовательностей ДНК хромосомы микроорганизмов рода Bordetella. // в Сб. тезисов докладов 13-ой Всесоюзной конференции по электронной микроскопии «Биология и медицина». Москва.-1988.-с.51.

9. Holzmayer T.A., Karataev G.I., Rozinov M.N., Moskvina I.L., Shumakov Y.L.,V.L.Motin, Mebel S.M., Gershanovich V.N., Kapaeva I.A. Bacteriophages of Bordetella sp.: Features of Lysogeny and Conversion.//Zbl. Bakt. Hyg.-1988. -v.269. -p.147-155.

10. Каратаев Г.И., Москвина И.Л., Рябинина О.П., Миллер Г.Г., Мебель С.М., Лапаева И.А. Выделение и характеристика бактериофага из вакцинного штамма Tohama I фазы.//Молек. генетика, микробиология и вирусология. -1988.-№4.-с. 22-25.

11. Каратаев Г.И., Нечаева Е.В., Синяшина Л.Н., Лапаева И.А. Видоспецифический ДНК-зонд для идентификации микроорганизмов рода Bordetella.// Тез. Докладов Республиканской конференции «новые методы диагностики СПИД, других вирусных и бактериальных инфекций в практике инфекционной и противоэпидемической службы». Алушта.-1990.-с.79-80.

12. Волгина Т.И., Кириллов М.Ю Нечаева Е.В., Шумаков Ю.Л., Лапаева И.А., Каратаев Г.И Новый мобильный элемент B. pertussis. //Тез. Докладов Всесоюзной школы-семинар «Молекулярная биология и медицина». Москва.-1990.-с.39.

13. Каратаев Г.И., Кириллов М.Ю Нечаева Е.В., Шумаков Ю.Л., Волгина Т.И., Лапаева И.А. Структурные особенности участков ДНК, содержащих “vir” и “tox” гены B. pertussis.//Тез. Докладов Всесоюзной школы-семинар «Молекулярная биология и медицина». Москва.-1990.-с.38.

14. Каратаев. Г.И., Шумаков Ю.Л., Кириллов М.Ю., Волгина Т.И., Лапаева И.А. Структурная организация участка хромосомы, содержащего vir-ген B. pertussis.//Молек.генетика, микробиология и вирусология.-1990.-т.12.-c.27-34.

15. Нечаева Е.В., Волгина Т.И., Кириллов М.Ю., Шумаков Ю.Л., Лапаева И.А., Каратаев Г.И. Мобильный элемент RSBP1 Bordetella pertussiss.//Молек. генетика, микробиология и вирусология.-1990. -т.12.-с.22-27.

16. Каратаев Г.И., Шакирова Р.Г., Карпухин А.В. Высокочувствительный ДНК-зонд для идентификации возбудителя коклюша.// в Сб. материалов 2-го Всесоюзного симпозиума теоретических и прикладных аспектов молекулярной биологии. Самарканд. -1991.-с.84.

17. Шумаков Ю.Л., Кириллов М.Ю., Бутчер С., Нечаева Е.Н., Руниберг-Ньюман К., Каратаев Г.И. Нуклеотидная последовательность и свойства транспозоноподобной структуры, клонированной из хромосомы Bordetella pertussis. // Генетика.-1993.- N7.-c.1061-1069.

18. Шумаков Ю.Л., Кириллов М.Ю., Нечаева Е.В., Синяшина Л.Н., Каратаев Г.И. Нуклеотидная последовательность и свойства транспозоноподобной структуры, клонированной из хромосомы B. pertussis.//Генетика.-1993.-т.29.-c.1061-1069.

19. Кириллов М.Ю., Шумаков Ю.Л., Нечаева Е.В., Синяшина Л.Н, Каратаев Г.И. Нуклеотидная последовательность и свойства инвертированного повторяющегося элемента хромосомы B. рertussis. //Генетика.-1993.-т.29.-c.1267-1276.

20. Kirillov M.Y., Shumakov Y., Nechaeva E.V, Butcher S., Sinjashina L. N., Runeberg K., Romantschuk M., Karataev G. I. Repeated sequences isolated from Bordetella pertussis induce DNA rearrangements and deletions at high frequency //Gene. -1995.-v.166.-p.111-116.

21. Боковой А.Г., Волкова Т.А., Кабишева Е.В., Каратаев Г.И., Кульнева Г.М. Специфическая диагностика коклюша у детей методом ДНК-зондирования. //Клинический вестник.-1996,-№3.-с.15-16.

22. Лыткина И.Н., Макаров В.Б., Семина С.В., Каратаев Г.И. Выявление возбудителя коклюша в клинических образцах с помощью ПЦР.//Сб.Актуальные вопросы эпидемиологии инфекционных болезней. В.2. Москва -1997.-с.144 –148.

23. Синяшина Л.Н. Кириллов М.Ю., Карпухин А.В., Богуш А.И., Боковой А.Г., Каратаев Г.И. Выявление возбудителя коклюша в клинических образцах методом ДНК-ДНК гибридизации.// В сб. Актуальные вопросы эпидемиологии инфекционных болезней. Вып.2, Москва, 1997.-с.149-153.

24. Кириллов М.Ю., Нечаева Е.В., Каратаев Г.И. Мобильный генетический элемент хромосомы B.pertussis стимулирует образование коинтегратов в штаммах E.coli// Генетика.-1997.-т.33.-c.1621-1628.

25. Артемьев М.И., Сметанина С.Е., Барановский П.М., Зуева Е.Н., Смирнов В.Д., Каратаев Г.И. Количественная оценка мишени методом ПЦР.// Сб. тезисов докл. 3-й Всероссийской научно-практической конференции. Москва.-2000.-с.341-342.

26. Нечаева Е.В., Сивов И.Г. Каратаев Г.И. Транспозиция и наследование Tn -элемента Bordetella в клетках Escherichia Coli K12.// Молек.генетика, микробиология и вирусология.-2000.-т.1.-с.20-23.

27. Сивов И.Г., Белявский О.А., Каратаев Г.И. Интеграция плазмиды в хромосому Escherichia Coli K12, обусловленная транспозоном Bordetella. // Мол. генетика, микробиология и вирусология.-2000.-т.2.-c.33-36.

28. Каратаев Г.И., Синяшина Л.Н., Сивов И.Г. Мигрирующие генетические элемены Bordetella pertussis, как генетические и эпидемиологические маркеры // Вестник РАМН.-2000.-N1.-c.34-38.

29. Сивов И.Г., Большакова Т.Н., Каратаев Г.И. Интеграция и внутримолекулярное перемещение транспозона TnBp3 B.pertussis в клетках E.coli K-12, мутантных по белку Hpr фосфоенолпируват-зависимой фосфотрансферазной системы// Генетика.-2001.-т.37.-c.900-907.

30. Воронцов В.В., Сивов И.Г., Умяров А.М., Синяшина Л.Н., Каратаев Г.И. Определение открытой рамки считывания, кодирующей транспозазу RS- элемента Bordetella pertussis// Генетика.-2004.-т.1.-с.16-23.

31. Синяшина Л.Н., Воронцов В.В, Сёмин Е.Г., Честков А.В., Цыганков Ю.Д., Каратаев Г.И. Bvg–негативная регуляция перемещений повторяющихся последовательностей в клетках B. perussis//Генетика.-2005,-№12.-с.1–9.

32. Воронцов В.В., Сивов И.Г., Умяров А.М., Синяшина Л.Н., Каратаев Г.И. Функциональная активность транспозазы IS–элемента B.pertussis в клетках E.coli.// Генетика.-2006.-№1.-c.39-48

33. Синяшина Л.Н., Каратаев Г.И. Молекулярное подтверждение лизогенности микроорганизмов рода Bordetella и характеристика умеренного бактериофага Bordetella parapertussis 662-2.//Генетика.-2006.-№3.-с.1–10.

34. Sinyashina L. N., Medkova A.Yu.,. Semin E. G., Chestkov A.V., Tsygankov Y.D., Karataev G. I. IS481-Induced Variability of Bordetella pertussis//In "National Institute of Allergy and Infectious Diseases, NIH: Frontiers in Research" Ed. Vassil St. Georgiev, Humana Press, Totowa, NJ.-2008.-p.227-231.

Список сокращений

МГЭ – мобильный генетический элемент

RS – повторяющаяся последовательность

IS – инсерционный элемент, повторяющаяся последовательность, обладающая свойствами МГЭ.

Tn – транспозон, мобильный генетический элемент

ФТС –фосфоенолпируватзависимая фосфотрансферазная система

т.п.н. – тысяча нуклеотидных пар

п.н. – нуклеотидные пары

н.м. – нанометр

кДа – килодальтон, единица измерения молекулярного веса белка

КУА – казеиново угольный агар, среда культивирования бактерий Bordetella

ЛСА – лейкоцитозстимулирующая активность коклюшного токсина

ТЛТ – термолабильный токсин

МАТ – моноклональные антитела

ВОЗ – Всемирная Организация Здравоохранения

ВС – внутренний стандарт

а.к. - аминокислота



 



<
 
2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.