WWW.DISUS.RU

БЕСПЛАТНАЯ НАУЧНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

Клинико-генетический анализ наследственных аксонопатий, обусловленных нарушением формирования хондриома

Представлены сведения о предстоящей защите диссертации

Щагина Ольга Анатольевна

«Клинико-генетический анализ наследственных аксонопатий, обусловленных нарушением формирования хондриома»

03.00.15 – генетика

03.00.26 – молекулярная генетика

медицинские науки

Д 001.016.01

ГУ Медико-генетический научный центр РАМН

115478, Москва, ул. Москворечье, 1, МГНЦ РАМН

email – oanatsh@mail.ru

представлена на сайте МГНЦ – 12.04.2007

предполагаемая дата защиты диссертации – 15.05.2007

На правах рукописи

Щагина Ольга Анатольевна

КЛИНИКО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ НАСЛЕДСТВЕННЫХ АКСОНОПАТИЙ, ОБУСЛОВЛЕННЫХ НАРУШЕНИЕМ ФОРМИРОВАНИЯ ХОНДРИОМА


03.00.15 – «Генетика»

03.00.26 «Молекулярная генетика»

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата медицинских наук

МОСКВА, 2007

Работа выполнена в ГУ Медико-генетический научный центр РАМН

Научные руководители:

доктор медицинских наук, профессор Е.Л. Дадали

доктор биологических наук, профессор А.В. Поляков

Официальные оппоненты:

доктор биологических наук П.А. Сломинский

доктор медицинских наук Г.Е. Руденская

Ведущая организация: ГОУ ДПО «РМАПО Росздрава»

Защита диссертации состоится «___»___________ 2007 г. в ___ часов на заседании Диссертационного совета Д 001.016.01 при ГУ МГНЦ РАМН по адресу: Москва, 115478, ул. Москворечье, д.1.

С диссертацией можно ознакомиться в библиотеке ГУ МГНЦ РАМНАвтореферат разослан «___»___________ 2007 г.

Ученый секретарь Диссертационного совета,доктор биологических наук, профессор Л.Ф. Курило

Актуальность исследования


Исследованиями последних лет показано, что нарушение структуры и функций митохондрий лежит в основе патогенеза ряда распространенных наследственных нейродегенеративных заболеваний, что связано с повышенной чувствительностью нервной ткани к дисбалансу энергетических процессов. Мутации в генах, белковые продукты которых участвуют в обеспечении биохимических процессов в митохондриях, являются причиной возникновения заболеваний из группы наследственных спастических параплегий, прогрессирующих мышечных дистрофий, атаксий, экстрапирамидных заболеваний [Schon & Manfredi, 2003; Santel, 2005]. Установление значительной роли нарушений функционирования митохондрий в патогенезе тех или иных наследственных заболеваний имеет существенное значение, так как позволяет повысить эффективность их лечения, посредством назначения специфической метаболической терапии.

В последние годы идентифицировано три генетических варианта наследственных моторно-сенсорных нейропатий (НМСН), обусловленных мутациями в генах, белковые продукты которых вносят существенный вклад в формирование структуры и функционирования хондриома (разветвленных митохондриальных сетей) аксонов периферических нервов. Один из этих генов -MFN2 (1p35-36) - приводит к возникновению НМСН IIА2 типа [Zuchner et al., 2004], второй - GDAP1 (8q21.1), обуславливает возникновение НМСН IVА типа [Baxter et al., 2002] и третий, DNM2 (19p12), приводит к возникновению редкого промежуточного варианта аксонопатии – НМСН ДП 1В [Zuchner et al., 2005]. Белковые продукты этих генов регулируют слияние и разделение митохондрий в процессе формирования хондриома [Mozdy et al., 2003].

НМСН – одна из наиболее распространенных групп наследственных заболеваний человека, частота которых в различных популяциях варьирует от 10 до 40 на 100000 населения [Федотов, 2002; Skre, 1974]. НМСН делят на две большие группы: миелинопатии (НМСН I типа) и аксонопатии (НМСН II типа). Идентификация I и II типа НМСН на клиническом уровне возможна только на основе электромиографического исследования с определением скоростей проведения импульса (СПИ) по срединному нерву. Показана выраженная генетическая гетерогенность этой группы заболеваний, которая к настоящему времени включает около 30 генетических вариантов, для 22 из которых идентифицированы гены, ответственные за развитие заболевания [http://www.neuro.wustl.edu/neuromuscular/time/hmsn.html]. Клинические проявления отдельных генетических вариантов имеют значительное сходство. Все это затрудняет диагностический этап медико-генетического консультирования и обуславливает необходимость проведения анализа частот встречаемости и особенностей клинических проявлений различных генетических вариантов НМСН [Дадали и др., 2003]. Результаты таких исследований должны явиться основой для создания алгоритма молекулярно-генетической диагностики, позволяющего определить очередность исследования мутаций в тех или иных генах, ответственных за развитие наследственных аксонопатий, что позволяет снизить временные и экономические затраты. В последние несколько лет в ряде популяций проведены исследования, направленные на изучение частоты и спектра мутаций в генах белков, обеспечивающих формирование митохондриальных сетей. Показано, что эти генетические варианты составляют существенную долю в структуре наследственных аксонопатий в группах больных ряда европейских стран [Kijima et al., 2005; Lawson et al., 2005; Nelis et al., 2002], однако в выборке больных проживающих на территории РФ такого рода исследования не проводились.

Целью работы явилось проведение клинико-генетического анализа аксонопатий, обусловленных нарушением структуры и функции хондриома и разработка алгоритмов их молекулярно-генетической диагностики на материале выборки больных, проживающих на территории РФ.

Для осуществления поставленной цели решались следующие задачи:

  1. Определить доли и спектр мутаций трёх генов – MFN2, DNM2 и GDAP1, - ответственных за формирование хондриома, в выборке российских больных наследственными аксонопатиями.
  2. Выявить наиболее часто встречающиеся мутации, установить причины их распространенности и разработать эффективные системы их регистрации.
  1. Оценить спектр основных клинических симптомов и частоту их встречаемости при различных вариантах аксонопатий, обусловленных мутациями в генах MFN2, и GDAP1.
  2. На основании полученных результатов и анализа литературных данных разработать алгоритм молекулярно-генетического обследования больных наследственными аксонопатиями.


Научная новизна

Впервые в выборке больных, проживающих на территории РФ оценены частоты встречаемости НМСН IIA, НМСН IVA и НМСН промежуточного IB типов, обусловленных мутациями генов MFN2, GDAP1 и DNM2, белковые продукты которых обеспечивают динамические процессы в хондриоме аксонов. Определен спектр мутаций в генах MFN2 и GDAP1. Установлен вклад мутаций этих генов в структуру заболеваемости НМСН. Описаны две ранее не известные мутации гена MFN2 и одна гена GDAP1.

В гене MFN2 выявлена «горячая» точка мутаций - кодон 94, а в гене GDAP1 – частая мутация Leu239Phe. Установлено, что причиной распространенности мутации Leu239Phe является эффект основателя и определен «возраст» мутации.


Практическая значимость

Разработаны протоколы ДНК-диагностики для выявления мутаций в генах MFN2 и GDAP1 и алгоритмы молекулярно-генетического обследования больных. Определены диагностические критерии, позволяющие проводить дифференциальную диагностику НМСН IIA и НМСН IVA при клиническом осмотре больного.

Результаты проведенного исследования могут быть использованы в работе диагностических лабораторий и практической работе врачей-генетиков и неврологов, работающих в области наследственной патологии нервной системы.


Положения, выносимые на защиту


  1. Мутации гена MFN2 являются причиной наследственной аксонопатии у 17% семей, у 8% семей причиной заболевания являются мутации гена GDAP1.
  2. В гене MFN2 выявлена частая мутация - Arg94Gln, - на долю которой приходится 42% случаев НМСН IIА у неродственных пробандов. В гене MFN2 имеется «горячая» точка – кодон 94.
  3. Выявлена частая мутация гена GDAP1 (НМСН IVА) у больных, проживающих на территории РФ - Leu239Phe.
  4. Причиной высокой частоты мутации Leu239Phe гена GDAP1 является эффект основателя. «Возраст» мутации оценен в 1000±600 лет.
  5. Существуют статистически достоверные отличия по частотам основных неврологических симптомов в группах больных с НМСН IIA и НМСНIVA типов, позволяющие диагностировать их при клиническом осмотре.
  6. Разработан алгоритм молекулярно-генетического обследования больных наследственными аксонопатиями и разработаны эффективные системы диагностики частых мутаций генов MFN2 и GDAP1.


Апробация работы


По материалам исследования опубликованы 14 научных работ, включая 7 статей. Материалы диссертации доложены на конференциях European Human Genetics Conference 2005 и 2006, на V съезде Российского общества медицинских генетиков 2005, на Международной Школе Молодых Ученых по Молекулярной генетике Геномика и Биотехнология 2006 и на IX всероссийском съезде неврологов 2006.


Объем и структура работы


Диссертация изложена на 133 станицах машинописного текста; включает введение, обзор литературы, описание материалов и методов исследования, результаты собственного исследования и их обсуждение, заключение, выводы, список использованной литературы. Библиография содержит 17 отечественных и 85 зарубежных источников. Диссертация иллюстрирована 22 таблицами и 24 рисунками.


СОДЕРЖАНИЕ РАБОТЫ


Материалы и методы исследования


Материалом для исследования являлись образцы ДНК, выделенные из периферической крови 110 больных в возрасте от 4 до 60 лет (52 мужчины и 48 женщин), из 72 неродственных семей с наследственной аксонопатией и 36 их клинически здоровых родственников. В качестве группы сравнения использовались образцы ДНК, выделенные из крови 300 здоровых доноров, проживающих на территории различных областей РФ.

Выделение геномной ДНК из лейкоцитов периферической крови выполняли с помощью готового набора реактивов для выделения DIAtomтм DNA Prep100 (Isogene Lab.ltd., Россия) по протоколу производителя.

Амплификацию всех исследуемых фрагментов ДНК проводили методом ПЦР на программируемом термоциклере МС2 фирмы «ДНК-технология» (Россия) с использованием оригинальных олигонуклеотидных праймеров, которые синтезировались в НПФ «Литех» или НПО“SYNTOL”

Для выявления изменений нуклеотидной последовательности генов MFN2, GDAP1 и DNM2 использовался метод SSCP-анализа (single strand conformation polimorphism) со щелочной денатурацией и автоматическое секвенирование, которое проводилось согласно протоколу фирмы-производителя на приборе ABI Prism 3100 (Applied Biosystems, CША). В качестве матрицы для секвенирования использовали фрагменты ДНК, полученные после проведения ПЦР. Анализ результатов секвенирования осуществлялся с помощью программ Chromas и BLAST (http: //w w w. ncbi.nlm.n ih.gov/blast).

Исследование микросаттелитных и SNP маркеров проводилось методами ПДАФ (полиморфизм длины амплификационных фрагментов) - и ПДРФ (полиморфизм длины рестрикционных фрагментов) - анализа, соответственно. Результаты оценивали с помощью электрофореза в полиакриламидном геле с последующим окрашиванием геля раствором бромистого этидия и регистрацией с помощью документирующей системы GelDoc фирмы BIO-RAD (США) в УФ-излучении. В работе использовали эндонуклеазы производства фирмы «СибЭнзим», (Россия) и «Fermentas», (Литва).

При сравнении частот аллелей в хромосомах с мутациями Arg94Gln гена MFN2 и Leu239Phe гена GDAP1 с частотой этих аллелей в популяции использовали точный критерий Фишера.

Для оценки неравновесности по сцеплению для полиморфных маркеров в группе больных использовали оценку = (PD – PN)/(1 – PN), где - мера неравновесности сцепления, PD – частота ассоциированного аллеля среди хромосом с мутацией, PN – частота этого же аллеля среди нормальных хромосом.

Для определения возраста мутации Leu239Phe гена GDAP1 применяли подход, основанный на понятии «генетических часов» и оценивающий количество поколений g с момента появления мутации в популяции до настоящего времени.

( - рекомбинационная фракция,

- мера неравновесности сцепления )


Результаты исследования и их обсуждение


Молекулярно-генетический анализ


В результате поведенного исследования выборки больных с наследственной аксонопатией оценена доля генетических вариантов, обусловленных мутациями генов, белки которых обеспечивают поддержание структуры хондриома. Показано, что на долю мутаций гена MFN 2, ответственного за возникновение НМСН IIА типа приходится 17% случаев заболевания, мутации гена GDAP1 являются причиной наследственных аксонопатий в 8% семей. Доля мутаций этих генов была существенно выше в семьях с подтвержденным АД или АР типом наследования заболевания и составила 25% и 40% соответственно. Мутаций гена DNM2 в исследованной выборке не выявлено (Рисунок 1).

 Доли мутаций генов MFN2, DNM2, GDAP1в выборке Российских больных. -0

Рисунок 1. Доли мутаций генов MFN2, DNM2, GDAP1в выборке Российских больных.

Полученные результаты соответствуют литературным данным о частотах встречаемости данных генетических вариантов.

Молекулярно-генетический анализ НМСН IIA

В гене MFN2, мутации которого ответственны за НМСН IIA нами обнаружено шесть различных миссенс-мутаций в 12 семьях, четыре из которых - Thr206Ile (c.617C>T), Arg94Trp (c.280C>T), Val705Ile (c.2113G>A) и Arg94Gln (c.281G>A) - были описаны ранее, а две мутации - Ser249Cys (c.745C>G) и Leu724Pro (c.2171C>T) идентифицированы впервые. Одна из мутаций - Arg94Trp - выявлена в двух неродственных семьях, другая - Arg94Gln - в пяти, мутация Thr206Ile – в двух семьях, остальные мутации обнаружены у единичных больных нашей выборки. Полученные результаты суммированы в таблице 1.

Таблица 1. Спектр выявленных мутаций гена MFN2

Экзон Нуклеотид-ная замена АК замена Клинический фенотип Тип наследования Число семей
EX4 с.280С>T Arg94Trp НМСН II АД, de-novo 2
EX4 c.281G>A Arg94Gln НМСН II, НМСН II с глухотой АД 5
EX7 c.617C>T Thr206Ile НМСН II с ранним началом de-novo 2
EX8 c.745C>G Ser249Cys НМСН II АД 1
EX18 c.2113G>A Val705Ile НМСН II АД 1
EX18 с.2065G>A Leu724Pro НМСН II АД 1

Чтобы установить природу высокой частоты мутации Arg94Gln, мы провели анализ гаплотипов хромосом с данной мутацией, используя как микросаттелитные маркеры, лежащие вблизи гена MFN2, так и внутригенные однонуклеотидные полиморфизмы (SNP).

По четырем микросаттелитным маркерам неравновесия по сцеплению с каким-либо из аллелей выявлено не было. По маркеру D1S2740 на всех хромосомах с мутацией был выявлен общий аллель «1», что связано с высокой частотой этого аллеля в популяции.

По внутригенным однонуклеотидным полиморфизмам, на хромосомах несущих мутацию Arg94Gln в 4 семьях был обнаружен общий гаплотип: rs2236055- rs3766744-rs873457-rs2236058: G-G-C-G (Таблица 2).

Таблица 2. Гаплотипы хромосом с мутацией Arg94Gln гена MFN2

Маркер Координата т.п.н. Пробанд
45.1 48.1 180.1 261.1 385.1
D1S2667 11 422 5 3 6 6 5
CA2120 11 572 5 1 5 5 4
D1S2740 11 855 1 1 1 1 -
AL096840/22 11 939 1 6 1 2 -
rs3753579 11973 C C/T C T T
rs2236055 11977 G G/A G G G
rs3766744 11978 G G/C G G G
rs873457 11981 C C/G C C/G G
R94Q 11987 M M M M M
rs2236058 11997 G G/C G G/C C
rs7550536 12001 T - G T T
rs730123 12005 G - A A/G G
D1S434 12 267 4 4 5 4 5
D1S228 13 732 4 4 4 3 6

При сравнении частот гаплотипа rs2236055- rs3766744-rs873457-rs2236058: G-G-C-G на хромосомах с мутацией Arg94Gln и хромосомах здоровых людей достоверных отличий выявлено не было (p=0,36). Действительно данный гаплотип является наиболее частым, и по нашим оценкам его частота в популяции составила 49% (Таблица 3).

Таблица 3. Частоты гаплотипа «G-G-C-G» на хромосомах с мутацией и в контрольной выборке

Группа Число исследованных хромосом Число хромосом с гаплотипом «G-G-C-G». Частота гаплотипа (p=0,05)
Хромосомы с мутацией Arg94Gln 5 4 0,8 (ДИ:0,46-0,94)
Контрольная выборка 82 40 0,49 (ДИ:0,47-0,50)

Таким образом, высокая частота данного гаплотипа на хромосомах с мутацией является не следствием эффекта основателя, а отражает ассоциации, существующие между аллелями изученных SNP в популяции.

Исходя из полученных данных по анализу гаплотипов, имеющихся в литературе описаниях случаев возникновения мутации Arg94Gln de novo [Verhoeven et al., 2006], и того, что еще в двух семьях нашей выборки причиной заболевания явилась мутация Arg94Trp того же кодона, мы сделали вывод, что в гене MFN2 имеется «горячая точка» в кодоне 94, мутации в котором являются причиной НМСН IIA у 58% больных, проживающих на территории РФ.

Такая высокая частота мутаций кодона 94 представляет уникальную возможность для оптимизации прямой ДНК-диагностики. Нами была создана система регистрации всех возможных миссенс/нонсенс мутаций этого кодона. Для чего был выбран праймер, во вторую букву с 3’ конца которого была введена замена A>G, являющаяся мягким мисс-метчем, таким образом, чтобы в нормальной последовательности появился сайт узнавания для рестриктазы Eco88I, в который входят обе первые буквы кодона 94 (Рисунок 2).

Рисунок 2.Система идентификации мутаций кодона 94 гена MFN2

а. GCTGGCTCGGAGGCACATGAAAGTGGCTTTTTTTGGCC

GCTGGC^TCGGGGGCACATGAAAGTGGCTTTTTTTGGCC

б.

а. Нормальная последовательность экзона 4 гена MFN2 и последовательность с введенной в праймер заменой. Подчеркнута последовательность праймера. Сайт узнавания эндонуклеазы Eco88I выделен рамкой, кодон 94 выделен жирным шрифтом.

б. Результаты ПДРФ анализа фрагмента, соответствующего экзону 4 гена MFN2.

Молекулярно-генетический анализ НМСН промежуточного IB типа

Нами проведено исследование всех экзонов гена DNM2 у всех больных нашей выборки.

Кроме описанных ранее полиморфизмов, было обнаружено два изменения нуклеотидной последовательности. В интроне 16 у трех пробандов нашей выборки была выявлена вставка одного нуклеотида с.1881+31insC, не описанная как полиморфизм, в гетерозиготном состоянии. Исследование нормальной и измененной последовательностей гена с помощью программы предсказания сайтов сплайсинга NetGene2 (http://www.cbs.dtu.dk/services/NetGene2) показало, что insC не влияет на сайты сплайсинга. Исследование методом SSCP-анализа 50 (100 хромосом) здоровых неродственных доноров из различных регионов РФ выявило трёх гетерозиготных и одного гомозиготного носителя инсерции. Таким образом, вставка нуклеотида c.1881+31insC является полиморфным вариантом, аллельная частота которого составляет 5%.

В экзоне 8 у одного пробанда была выявлена замена с.1077С>T (Gly359Gly), не приводящая к замене аминокислоты. Была подобрана эндонуклеаза рестрикции Hin6I, режущая нормальную последовательность и проведено исследование 200 (400 хромосом) неродственных доноров, из различных регионов России. Ни у одного из контролей данной замены выявлено не было. Мы исследовали нормальную и измененную последовательность экзона 8 с помощью программ предсказания сайтов сплайсинга NetGene2 (http://www.cbs.dtu.dk/services/NetGene2) и BDGP (http://www.fruitfly.org/seq_tools/splice.html). Замена c.1077C>T не изменяет вероятность сайтов сплайсинга. Из полученных данных нельзя сделать однозначного вывода о том, является ли эта замена очень редким полиморфизмом или причиной заболевания в данной семье.

Молекулярно-генетический анализ НМСН IVA

В результате исследования всей кодирующей последовательности гена GDAP1, нами были выявлены мутации у 9 больных из 6 неродственных семей (Таблица 4).

Таблица 4.Мутации гена GDAP1.

Экзон гена GDAP1 Семья Мутация1 Мутация 2 Клинический фенотип Тип наследования
EX3 149 Pro153Leu (c.458C>T) n.d. НМСНII de novo?
EX6 294 Leu239Phe (с.715C>T) Leu239Phe (с.715C>T) НМСНII с атрофией зрительного нерва АР
EX6 552 Leu239Phe (с.715C>T) Leu239Phe (с.715C>T) НМСНII АР
EX6 374 Leu239Phe (с.715C>T) Leu239Phe (с.715C>T) НМСНII изолированный случай
EX6 312 Leu239Phe (с.715C>T) Arg257Stop (c.769C>T) НМСНII изолированный случай
EX6 558 Leu239Phe (с.715C>T) n.d. НМСНII АР

В трех семьях у пробандов была выявлена, ранее описанная рядом авторов, мутация Leu239Phe (с.715C>T) экзона 6 в гомозиготном состоянии, еще у двух больных эта мутация была выявлена в гетерозиготном состоянии. Данная мутация была описана ранее, как причина аксонопатии в семьях из Чехии и Польши. Кроме того, нами были выявлены две ранее не описанные мутации Pro153Leu и Arg257Stop.

Для установления природы высокой частоты мутации Leu239Phe, нами было выбрано 8 микросаттелитных маркеров с высокой гетерозиготностью, расположенных в интервале 8 м.п.н. вокруг гена GDAP1. Мы проанализировали частоты аллелей на хромосомах с мутацией и без мутации. Полное неравновесие по сцеплению было обнаружено по маркеру D8S286. По остальным маркерам также наблюдалось неравновесие по сцеплению (Таблица 5).

Таблица 5.Аллельные частоты маркеров (%), сцепленных с локусом НМСНIVA.

Аллельные частоты маркеров, для которых обнаружено наибольшее неравновесие по сцеплению подчеркнуты.

Мы определили значения неравновесия по сцеплению () для каждого аллеля всех исследованных маркеров, используя точный критерий Фишера для оценки достоверности ассоциации данного аллеля маркера с локусом НМСНIVA.

Таблица 6.Ассоциация и неравновесие по сцеплению аллелей маркеров с локусом НМСН IVA.

аллель P ± 95% ДИ
D8S279 9 0,035 0,21±0,28
D8S1776 2 0,480 0,18±0,51
D8S286 8 <0,001 1
D8S551 13 <0,001 0,89±0,22
GDAP1 c.715T
D8S548 3 0,003 0,83±0,33
D8S1805 1 0,005 0,41±0,36
D8S1705 5 0,041 0,37±0,39
D8S1757 8 0,003 0,42±0,35

р – вероятность ошибки для одностороннего варианта точного критерия Фишера.

– мера неравновесности сцепления аллелей полиморфных маркеров с локусом заболевания, ДИ – доверительный интервал

При построении гаплотипа основателя мы выбирали аллели характеризующиеся максимальной неравновесностью сцепления с локусом заболевания по сравнению с другими аллелями маркеров и имеющие большее накопление в хромосомах с мутацией по сравнению с другими аллелями (Таблица 6). Поэтому, при определении предкового аллеля, учитывали наибольшее положительное значение и наименьшее р среди всех аллелей данного маркера. Гаплотипы хромосом с мутацией Leu239Phe представлены в таблице 7.

Таблица 7. Гаплотипы хромосом с мутацией Leu239Phe

Маркер D8S279 D8S1776 D8S286 D8S551 c.715C>T D8S548 D8S1805 D8D1705 D8S1757
het 0,88 0,65 0,82 0,66 0,74 0,75 0,84 0,79
т.п.н. 73 151 73 667 75 244 75 371 75 439 75 821 78 257 80 408 81 202
сМ 91,46 92,58 94,61 95,15 95,15 96,21 97,28
5521 5 3 8 13 T 3 4 7 8
2941 5 3 8 13 T 3 1 5 8
558 7 6 8 13 T 3 4 5 12
5522 7 1 8 12 (!) T 3 1 6 7
3741 1 2 8 13 T 3 2 6 7
3742 9 2 8 13 T 3 1 3 1
2942 9 2 8 13 T 3 1 5 8
312 3 2 8 13 T 2 (!) 1 5 8

жирным шрифтом выделена сохраненная часть гаплотипа основателя

(!) обозначены мутантные аллели

Таким образом, наиболее вероятным нам представляется следующий гаплотип основателя: D8S279-D8S1776-D8S286-D8S551-D8S548-D8S1805-D8S1705-D8S1757: 9-2-8-13-3-1-5-8. Интересно, что в данном случае неравновесие по сцеплению определенных аллелей исследованных маркеров, как и достоверная ассоциация этих аллелей с локусом НМСНIVA, наблюдается на довольно продолжительном расстоянии от мутации: 3,54 сМ и 2,28 сМ соответственно в сторону центро- и теломеры. Это может быть связано с относительно небольшим возрастом эффекта основателя в популяции.

При расчете «возраста» мутации мы использовали значения неравновесия по сцеплению для маркеров D8S279, D8S1805, D8S1705 и D8S1757 для аллелей которых наблюдалась достоверная ассоциация с локусом НМСНIVA и мера неравновесности сцепления аллеля данного маркера с заболеванием лежала в пределах 0,20-0,50 (Таблица 8).

Таблица 8. Число поколений, прошедших с момента распространения мутации Leu239Phe

маркер g
D8S279 66,95
D8S1805 31,77
D8S1705 20,06
D8S1757 14,63
Среднее значение 33,35±20,36

g- число поколений

Среднюю продолжительность одного поколения мы принимали равной 30 годам, соответственно время, за которое была накоплена мутация, составляет около 1000±610 лет. Учитывая, что средний год рождения больных 1990, период начала распространения мутации IX-XI века, что соответствует историческим сведениям о заселении славянскими народами территории центральной России.

Клиническая характеристика больных

Клиническая характеристика больных с мутациями в гене MFN2

Нами проанализированы клинические проявления у 23 больных из 10 неродственных семей. 18 больных были членами трех больших семей, с сегрегацией заболевания в двух и более поколениях. Это позволило нам определить не только размах клинического полиморфизма НМСНIIA типа, но и оценить внутри и межсемейную вариабельность клинических признаков, а также проследить динамику формирования клинического фенотипа по мере прогрессирования заболевания (возраст больных на момент осмотра варьировал от 6 до 60 лет).

Клинические проявления были типичными для наследственных аксонопатий и характеризовались сочетанием блока моторных, сенсорных и координаторных расстройств. Возраст манифестации заболевания варьировал от 2 до 27 лет и в среднем составил 9,3±5,7 лет. Первыми в процесс вовлекались мышцы перонеальной группы, голени и стоп, что клинически появлялось вялым парезом, снижением мышечной силы в сгибателях голени, выпадением ахилловых рефлексов и появлением специфической степпажной походки. Поражение дистальных мышц ног достаточно быстро приводило к формированию полой стопы (pes cavus). У 16 из 22 больных в патологический процесс вовлекались мышцы кистей (межкостные, а также мышцы тенара и гипотенара). Деформация кистей по типу «когтистой лапы» наблюдалась у 15 больных. Характерным симптомом заболевания был тремор пальцев вытянутых рук постурально кинетического характера, который выявлялся у 18 больных и отсутствовал только у 5 больных в возрасте от 6 до 14 лет. У большинства больных отмечено также выпадение карпо-радиального рефлекса, он оставался сохранным лишь у двух больных в возрасте 14 и 27, не имеющих деформации и слабости мышц кисти. Снижение или отсутствие коленного рефлекса отмечено лишь у 14 из 24 больных (58%). У большинства пораженных детей и лиц молодого возраста коленный рефлекс оставался сохранным. Еще более длительное время сохранялся рефлекс с двуглавых мышц, угнетение которого выявлено только у 9 больных (38%) с длительностью течения заболевания от 17 до 54 лет. Интересно отметить, что расстройства глубокой чувствительности зарегистрировано лишь у 8 больных, в то время как координаторные нарушения отмечены у 17 больных. По мере прогрессирования заболевания у 7 больных отмечалась более выраженная генерализация процесса с распространением поражения на мышцы бедер. У двух больных в возрасте 54 и 60 лет с длительностью заболевания от 44 до 54 лет отмечалось также снижение глоточного и небного рефлекса и двухсторонняя нейросенсорная тугоухость.

При проведении электромиографического обследования у всех больных отмечались признаки аксонального поражения, в виде снижения амплитуд сенсорных потенциалов и М-ответов в сочетании с нормальными или несколько сниженными показателями скоростей проведения импульса (СПИ) по моторным волокнам периферических нервов и потенциалами фибрилляции. Показатели СПИ по срединному нерву варьировали от 41,6 м/с до 66,8м/с и в среднем составляли 53,6±8,2 м/с.

Суммируя результаты клинико-электромиографического обследования больных нашей выборки и литературных данных можно выделить следующие критерии диагностики этого генетического варианта на клинической стадии обследования больного, дающие основание для направления его на исследование мутаций в гене MFN2:

  • АД наследование, единственный больной в семье,
  • возраст манифестации от 2 до 27 лет,
  • преобладание двигательных нарушений над чувствительными,
  • значительные координаторные нарушения и отсутствие выраженных расстройств чувствительности,
  • постурально-кинетический тремор пальцев рук,
  • аксональный уровень поражения, регистрируемый при проведении электромиографического исследования. СПИ по срединному нерву соответствует контрольным значениям или имеет промежуточные значения.

Клиническая характеристика больных с мутациями в гене GDAP1

Нами проанализированы особенности клинических проявлений и электромиографических параметров у 9 больных (4 мужского и 5 женского пола) в возрасте от 9 до 34 лет с НМСН IVA, обусловленной мутацией в гене GDAP1.

Возраст появления первых симптомов варьировал от 1 года до 5 лет и в среднем составлял 2,6±1,6 года. Первые признаки заболевания, на которые обращали внимание родители больных, была деформация стоп по типу полых, а также слабость перонеальных групп мышц, приводящая к появлению степпажной походки. В течение нескольких лет в патологический процесс распространялся в восходящем направлении с вовлечением сгибательных и разгибательных групп мышц голеней, а также межкостных мышцы кистей и мышц тенара и гипотенара. Нарастание вялого тетрапареза приводило к выраженной эквино-варусной деформации стоп, а спустя 2-3 года от момента манифестации заболевания возникала деформация кистей по типу «когтистой лапы» или «обезьяньей лапы».

Характерной особенностью НМСН IVA типа было раннее выпадение сухожильных рефлексов с нижних и верхних конечностей, что свидетельствовало о быстром вовлечении в патологический процесс крупных миелинизированных нервных волокон. У всех обследованных больных обнаруживались также выраженные расстройства глубокой чувствительности, что также свидетельствовало о тяжести поражения крупных нервных волокон аксонов, так как известно, что появление значимых сенсорных нарушений возникает при нарушении функционирования не менее 60% аксонов. У 6 обследованных больных в возрасте от 17 до 29 лет, наряду с выпадением глубокой чувствительности, отмечалась поверхностная гипостезия, что свидетельствовало в пользу значительной генерализации процесса по мере прогрессирования заболевания.

Наряду с этим у всех больных отмечались симптомы спино-церебеллярной атаксии, значительно усиливающиеся при отсутствии контроля зрения. Ни у одного наблюдаемого нами больного не отмечено нарушения функции черепно-мозговых нервов, а также вовлечения в процесс лицевой мускулатуры. Интересно, также, отметить отсутствие у больных с НМСН IVA типа тремора пальцев кистей и фасцикулярных подергиваний различных мышечных групп, которые нередко наблюдаются при других генетических вариантах наследственных аксонопатий. Наряду с этим, в обследованной нами выборке больных, не выявлено двух описанных ранее симптомов, которые с разной частотой отмечались у больных НМСН с мутациями в гене GDAP1 из других популяций - огрубление голоса, которые авторы связывают с парезом голосовых связок, и пирамидной симптоматики в нижних конечностях [Claramunt et all, 2005].

При проведении электромиографического обследования отмечены характерные признаки аксонопатий, причем наиболее выраженным оказывалось поражение сенсорных волокон периферических нервов. В пользу этого свидетельствовало значимое снижение амплитуды потенциала действия и СПИ преимущественно чувствительных волокон, в то время как этот показатель, измеренный в отдельных сегментах моторных волокон зачастую находился в пределах контрольных значений.

Суммируя результаты клинико-электромиографического обследования больных нашей выборки и литературных данных можно выделить следующие критерии диагностики этого генетического варианта на клинической стадии обследования больного, дающие основание для направления его на исследование мутаций в гене GDAP 1:

  • начало заболевания в возрасте до 5 лет,
  • грубые деформации стоп по типу эквино-варусных,
  • быстрое прогрессирование заболевания с распространением патологического процесса на передние и задние группы мышц голеней и мышцы кисти,
  • раннее выпадение сухожильных рефлексов с мышц верхних и нижних конечностей,
  • выраженные расстройства всех видов чувствительности, с первоочередным выпадением глубокой чувствительности,
  • аксональный уровень поражения, регистрируемый при проведении электромиографического исследования. СПИ по срединному нерву в большинстве случаев соответствует контрольным значениям или имеет промежуточные значения.

Сравнительный анализ клинических проявлений у больных НМСН IIA и НМСН IVA

При сравнении анализируемых групп больных с выявленными мутациями генов MFN2 и GDAP1, выявлены клинические признаки, достоверно чаще встречающиеся в одной из двух групп больных (Таблица 9).

Таблица 9. Сравнительные данные о частотах встречаемости клинических признаков в группах больных с мутациями в генах MFN2 и GDAP1.

признак ген
MFN2 GDAP1 P
Число исследованных больных 24 9
Возраст манифестации (лет) 9,3± 5,7 (2-27) 2,9±1,6 (1-5)
Снижение/отсутствие ахиллова рефлекса 100% 100% 1
Снижение/отсутствие коленного рефлекса* 58% 100% 0,032
Снижение/отсутствие карпо-радиального рефлекса 92% 100% 1
Снижение/отсутствие рефлекса с двуглавой мышцы* 38% 100% <0,001
Тремор пальцев кистей* 75% 0% <0,001
Координаторные расстройства 71% 100% 0,15
Деформация стоп 100% 100% 1
Деформация кистей* 63% 100% 0,039
Поверхностная гипоестезия в руках 50% 67% 0,46
Поверхностная гипоестезия в ногах 50% 67% 0,46
Расстройства глубокой чувствительности* 25% 100% <0,001
СПИ n. medianus (м/с) 53,6±8,2 (41,6-66,8) 44,7±7,4 (32,0-54,0)

р – вероятность ошибки для одностороннего варианта точного критерия Фишера.

*Клинические признаки, для которых выявлены статистически достоверные различия в двух группах больных.

Как видно из таблицы 9, в двух анализируемых группах больных выявлены достоверные различия частот встречаемости пяти из 13 анализируемых признаков.

Такие признаки, как снижение/отсутствие коленного рефлекса, рефлекса с двуглавой мышцы, отсутствие тремора пальцев, деформация кисти, расстройство глубокой чувствительности встречаются достоверно чаще среди больных с мутациями в гене GDAP1. Для этой же группы больных характерен ранний (1-5 лет) возраст манифестации заболевания, хотя и у нескольких больных с НМСН IIA заболевание манифестировало до 5 лет.

По электронейромиографическому критерию – СПИ по срединному нерву группы больных не различаются, и в той и другой группе наблюдается аксональный уровень поражения. СПИ по срединному нерву в большинстве случаев соответствовала нормальным значениям или имела промежуточные значения.

Алгоритм молекулярно-генетического обследования больных с аксонопатиями

На основании результатов собственных исследований, и обобщения литературных данных о частоте встречаемости и особенностях клинических проявлений наследственных аксонопатий с АД и АР типами наследования нами разработан алгоритм молекулярно-генетического обследования семейных и изолированных случаев этой группы заболеваний. Предложенный алгоритм представлен на рисунках 3, 4.

Анализ литературных данных показал, что классическая клиническая картина периферической полинейропатии характерна для трех генетических вариантов наследственных аксонопатий с АД типом наследования - НМСН IIA, НМСН IIЕ и НМСН IIF. Поэтому очередность их молекулярно-генетического исследования может диктоваться частотой встречаемости этих вариантов в группе наследственных аксонопатий и возрастом их манифестации. Два других генетических варианта с АД типом наследования, для которых идентифицированы гены – НМСН IIB и НМСН IID имеют ряд характерных особенностей, отличающих их от «классического» варианта этой группы заболеваний.

Самой частой причиной аксонопатий являются мутации гена MFN2, в семейном случае с АД типом наследования рекомендуется первоочередное исследование «горячей» точки гена MFN2 – кодона 94, и в случае отсутствия в ней мутаций дальнейшее исследование всей последовательности гена MFN2, и лишь после исключения его, как причины заболевания – исследование других генов, мутации которых приводят к клиническому фенотипу аксонопатии, исходя из размеров гена, так как для каждого из них существуют лишь единичные описания мутаций

В случае АР типа наследования заболевания или подозрении на него (кровно-родственный брак), рекомендуется поиск мутаций в гене GDAP1, с первоочередным анализом мутации Leu239Phe, которая в соответствии с результатами нашего исследования является причиной не менее 40% НМСН с АР типом наследования.

Анализ литературных данных показал, что к настоящему времени идентифицированы гены лишь двух вариантов наследственных аксонопатий с АР типом наследования, следовательно, молекулярно-генетическая диагностика АР форм аксонопатий может ограничиться поиском мутаций в генах GDAP1 и Lamin A/C (Рисунок 3).

Рисунок 3. Алгоритм молекулярно-генетической диагностики семейных случаев наследственных аксонопатий

«+» - мутация найдена «-» - мутация не обнаружена

Наибольшую сложность представляет создание алгоритма молекулярно-генетической диагностики в семьях с единственным больным. В этих случаях ориентиром могут служить возраст манифестации и тяжесть клинического течения (Рисунок 4).

Рисунок 4. Алгоритм молекулярно-генетической диагностики изолированных случаев наследственных аксонопатий

Так, в случае манифестации заболевания до 5 лет и быстрого прогрессирования заболевания целесообразно начинать диагностический поиск с исследования гена GDAP1, при отсутствии мутаций в этом гене идентификация генетического варианта может быть продолжена и направлена на анализ мутаций в гене MFN2, так как у небольшой части больных нашей выборки со IIА типом отмечалось раннее начало и злокачественное течение заболевания.

В случае более поздней манифестации заболевания целесообразно проводить исследование трех генов: MFN2, MPZ, NEFL, HSPB1, последовательность исследования которых диктуется частотой встречаемости НМСН IIA, НМСН IIJ, НМСН IIE и НМСН IIF.

Таким образом, разработанные нами алгоритмы будут способствовать оптимизации диагностики, позволяя снизить сроки проведения и стоимость ДНК-диагностики.

ВЫВОДЫ


  1. Установлен вклад мутаций трех генов – MFN2, DNM2, GDAP1, участвующих в формировании хондриома, в развитие наследственных аксонопатий в выборке больных проживающих на территории РФ. Среди 72 неродственных семей мутации гена MFN2 явились причиной заболевания в 12 семьях (17%). В шести семьях (8%) выявлены мутации гена GDAP1. Мутаций гена DNM2 в исследованной выборке не выявлено.
  2. Обнаружена частая мутация Arg94Gln гена MFN2, на долю которой приходится 42% случаев НМСН IIА. Анализ гаплотипов хромосом с данной мутацией показал её независимое происхождение во всех семьях. В том же кодоне у двух неродственных пробандов выявлена мутация Arg94Trp (у одного из пробандов de novo). Таким образом, в гене MFN2 имеется «горячая» точка мутаций – кодон 94, на долю которой приходится 58% подтвержденных случаев НМСНIIА. Разработана эффективная система диагностики этих мутаций.
  3. Установлено, что основной причиной НМСН IVA в российской выборке больных является мутация Leu239Phe (c.715C>T) гена GDAP1, выявленная в гомозиготном или компаунд-гетерозиготном состоянии в пяти из шести семей (80% хромосом с выявленной мутацией). Разработана система эффективной диагностики этой мутации.
  4. Анализ гаплотипов хромосом, несущих мутантный аллель Leu239Phe, показал, что причиной высокой частоты данной мутации является эффект основателя. Время распространения мутации составляет 1000±610 лет.
  5. На основании анализа основных неврологических симптомов в группах больных НМСН IIА и НМСН IVA выявлены 5 признаков достоверно чаще встречающиеся у больных с НМСН IVA. Для этой же группы больных характерен ранний (1-5 лет) возраст манифестации заболевания.
  6. Разработан алгоритм клинико-молекулярно-генетического обследования больных изолированными формами наследственных аксонопатий, определяющий последовательность анализа генов, ответственных за НМСН II и промежуточного типа в семьях с АД и АР типами наследования и в изолированных случаях заболевания.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИОННОЙ РАБОТЫ


  1. Evgrafov OV, Mersiyanova I, Irobi J, Van Den Bosch L, Dierick I, Leung CL, Schagina O, Verpoorten N, Van Impe K, Fedotov V, Dadali E, Auer-Grumbach M, Windpassinger C, Wagner K, Mitrovic Z, Hilton-Jones D, Talbot K, Martin JJ, Vasserman N, Tverskaya S, Polyakov A, Liem RK, Gettemans J, Robberecht W, De Jonghe P, Timmerman V. Mutant small heat-shock protein 27 causes axonal Charcot-Marie-Tooth disease and distal hereditary motor neuropathy// Nat Genet. 2004 Jun;36(6):602-6.
  2. O. Shagina, S. Tverskaya, H. Dadali, H. Osipova, R. Zinchenko, E. Ginter, A. Polyakov. Linkage study of a large CMT family from Udmurtia, Russian Federation. - European Journal of Human Genetics. V.12. – S.1 – June 2004. - P0722. - p. 240.
  3. Щагина О.А., Мерсиянова И.В., Дадали Е.Л., Федотов В.П., Поляков А.В. Картирование и идентификация генов болезни Шарко-Мари-Тута второго типа. Медицинская генетика, 2005, т.4, №8, стр.378-382.
  4. O. Schagina, E. Dadali, S. Tverskaya, A. Polyakov. Mutation screening in the GTPase mitofusin 2 cause Charcot-Marie-Tooth neuropathy type 2A – European Journal of Human Genetics. V.13 – S.1 – May 2005. P0896. – p. 274;
  5. Щагина О.А., Тверская С.М., Поляков А.В. Мутации в гене MFN2 – причина развития болезни Шарко-Мари-Тута 2А типа. // Медицинская генетика, 2005, т.4, № 6, с.292
  6. Поляков А.В., Мерсиянова И.В., ЕвграфовО.В., Щагина О.А Картирование и идентификация генов НМСН второго типа. // Медицинская генетика, 2005, т.4, № 6, С.253
  7. Гинтер Е.К., Зинченко Р.А., Осипова Е.В., Ельчинова Г.И., Галкина В.А., Дадали Е.Л., Хлебникова О.В., Щагина О.А., Близнец Е.А., Поляков А.В., Петрова Н.В., Козлова С.И.//Медико-генетическое изучение населения Республики Удмуртии. Сообщение IV. Спектр наследственных болезней в Республике Удмуртии.// Медицинская генетика, 2005, т.4., № 10, стр.454-465.
  8. Федотов В.П., Мерсиянова И.В., Исмаилов Ш., Щагина О., Тверская С.М., Никоноркин П.О. Популяционный молекулярно-генетический анализ наследственных мото-сенсорных нейропатий в Воронежской области.// Медицинская генетика, 2005, т.4, № 6, с.281
  9. O. A. Schagina, E. L. Dadali, V. P. Fedotov, A. V. Polyakov. Arg94Gln mutation in the MFN2 gene is most frequent in the patient with Charcot-Marie-Tooth type 2 disease from Russia.//(Control No. 2006-A-1112-ESHG).European Journal of Human Genetics,V.14.Supp.1.May 6-9, 2006. Амстердам, Р 0071,р.115
  10. Федотов В.П., Дадали Е.Л., Мерсиянова И.В., Щагина О.А., Поляков А.В. Клинический полиморфизм и генетическая гетерогенность наследственных моторно-сенсорных нейропатий.// тезисы IX всероссийского съезда общества неврологов, 2006, 29 мая-2 июня, с.100
  11. Щагина О.А., Мерсиянова И.В., Дадали Е.Л., Федотов В.П., Тверская С.М., Поляков А.В. ДНК-диагностика наследственной моторно-сенсорной нейропатии в России// тезисы IX всероссийского съезда общества неврологов, 2006, 29 мая-2 июня, с.102
  12. Щагина О.А., Дадали Е.Л., Поляков А.В. Нарушение структуры и функций хондриома, как причина возникновения наследственной моторно-сенсорной нейропатии 2А типа (обзор литературы)//Медицинская генетика, 2006, т.5.,№6
  13. Щагина О.А., Дадали Е.Л., Федотов В.П., Поляков А.В. Спектр мутаций в гене MFN2 у больных наследственной моторно-сенсорной нейропатией II А типа. // Медицинская генетика, 2006, т.5, № 9(51), с.21-26
  14. Щагина О.А., Дадали Е.Л., Федотов В.П., Осипова Е.В., Зинченко Р.А., Гинтер Е.К., Поляков А.В. Новый аллельный вариант наследственной моторно-сенсорной нейропатии 2А типа в Удмуртской семье//Медицинская генетика, 2007, т.6, №3








 



<
 
2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.