WWW.DISUS.RU

БЕСПЛАТНАЯ НАУЧНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

Антипролиферативное действие карнозина и его производных на опухолевые клетки нейрального происхождения

На правах рукописи

Рыбакова Юлия Сергеевна

АНТИПРОЛИФЕРАТИВНОЕ ДЕЙСТВИЕ КАРНОЗИНА И ЕГО ПРОИЗВОДНЫХ

НА ОПУХОЛЕВЫЕ КЛЕТКИ НЕЙРАЛЬНОГО ПРОИСХОЖДЕНИЯ

03.01.04 – биохимия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Москва - 2013

Работа выполнена в Федеральном государственном бюджетном учреждении

«Научный центр неврологии»

Российской академии медицинских наук

Научный руководитель: доктор биологических наук,

Федорова Татьяна Николаевна

Официальные оппоненты: Гривенников Игорь Анатольевич, доктор биологических наук, профессор, заведующий лабораторией молекулярной генетики соматических клеток Федерального государственного бюджетного учреждения науки Института молекулярной генетики Российской академии наук

Онуфриев Михаил Валерьевич, доктор биологических наук, ведущий научный сотрудник лаборатории функциональной биохимии нервной системы Федерального государственного бюджетного учреждения науки Институт высшей нервной деятельности и нейрофизиологии Российской академии наук

Ведущая организация: Научно-исследовательский институт клинической онкологии Федерального государственного бюджетного учреждения «Российский онкологический научный центр имени Н. Н. Блохина» Российской академии медицинских наук

Защита состоится «___» _____________ 2014 г. в 14 ч 00 мин. на заседании

Диссертационного Совета Д 001.002.01 в ФГБУ «НИИ питания» РАМН по адресу:

Москва, Устьинский проезд, д.2/14

С диссертацией можно ознакомиться в библиотеке ФГБУ «НИИ питания» РАМН.


Автореферат разослан ___ декабря 2013 г.

Ученый секретарь

Диссертационного совета

доктор биологических наук, профессор В.М.Коденцова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность исследования. Карнозин представляет собой природный дипептид, состоящий из двух аминокислот – -аланина и L-гистидина. В организме человека карнозин представлен во многих тканях, достигая наивысшей концентрации в мышцах (~ 20 мM) и головном мозге (~ 2.5 мM) (Margolis 1974, Mannion et al 1992). Карнозин синтезируется ферментом карнозин-синтетазой, которая катализирует образование пептидной связи между -аланином и L-гистидином, используя энергию АТФ и ионы Mg2+ (Horinishi et al 1978, Drozak et al 2010). Разрушение карнозина на составляющие его аминокислоты осуществляется главным образом сывороточной карнозиназой (CN1) (Hanson & Smith 1949, Teufel et al 2003). Карнозин демонстрирует многообразие функций, в том числе: протонный буфер в скелетных мышцах (Северин С. Е. 1953), хелатор двухвалентных металлов (Cu2+, Zn2+, Fe2+) (Boldyrev, 2012), антиоксидант (Dupin et al 1984, Kohen et al 1988, Chan et al 1994, Zhou & Decker 1999) и ингибитор пролиферации опухолевых клеток (Nagai and Suda 1986, Holliday and McFarland 1996, Renner et al 2010).

Впервые антипролиферативный эффект карнозина на опухолевые клетки описали Nagai и Suda в 1986 году. В их работе подкожные инъекции карнозина мышам линии ddY, с предварительно вживленными клетками саркомы, способствовали снижению интенсивности пролиферации опухолевых клеток и увеличению выживаемости животных. Позже в независимом исследовании Renner et al. (2010) на мышах с ксенографтами HER2/neu NIH3T3 фибробластов было показано, что ежедневные внутрибрюшинные инъекции карнозина существенно подавляют пролиферацию злокачественных клеток и опухолевый рост. Holliday и McFarland (1996) продемонстрировали избирательность действия карнозина на опухолевые клетки. Добавление карнозина к смеси клеток карциномы шейки матки (HeLa) и нормальных человеческих фибробластов (MRC-5) приводило к выборочному уничтожению опухолевых клеток и удлиняло продолжительность жизни фибробластов. Таким образом, на сегодняшний день накоплено достаточно экспериментальных данных об ингибирующем действии карнозина на пролиферацию опухолевых клеток, однако механизм противоопухолевого эффекта до сих пор остается не выясненным.

В настоящее время участие активных форм кислорода (АФК) и антиоксидантов в регуляции клеточной пролиферации хорошо обосновано и изучено (Menon and Goswami 2007, Burhans and Heintz 2009). Показано, что быстро пролиферирующие опухолевые клетки часто характеризуются более высоким содержанием АФК и пониженной активностью антиоксидантной системы по сравнению с нормальными клетками, делящимися медленно или находящимися в состоянии покоя (Goswami et al 2000, Sarsour et al 2012). Добавление небольших концентраций пероксида водорода к опухолевым клеткам активировало пролиферативные процессы, а повышение экспрессии антиоксидантного фермента митохондриальной супероксиддисмутазы, наоборот, пролиферацию замедляло (Laurent et al 2005, Weydert et al 2006). Карнозин демонстрирует эффективные антиоксидантные свойства, которые заключаются в его способности образовывать комплексы с двумя высоко реакционноспособными окислителями – гидроксильным радикалом и супероксидным анионом, снижая их реактивность и предотвращая дальнейшее распространение окислительного повреждения (Chan et al 1994, Klebanov et al 1997). Кроме того, в нескольких независимых исследованиях было продемонстрировано эффективное подавление накопления продуктов перекисного окисления липидов в присутствии карнозина, что снижало уровень окислительного повреждения макромолекул, способствуя сохранению их структуры и функций (Dupin et al 1984, Kohen et al 1988, Zhou and Decker 1999). Исходя из литературных данных, мы предположили, что ингибирующий эффект карнозина на пролиферацию опухолевых клеток может быть опосредован его антиоксидантными свойствами.

Работа выполнена в соответствии с планом НИР ФГБУ «НЦН» РАМН в рамках темы №146 «Исследование в условиях in vitro и in vivo проблем эффективности безопасности наноструктурных комплексов, обладающих нейропротекторным действием».

Цель исследования. Изучение механизма антипролиферативного действия карнозина и его производных на опухолевые клетки нейрального происхождения.

Задачи исследования:

1. Изучить характер воздействия карнозина на пролиферацию линий опухолевых клеток феохромоцитомы крысы (РС-12), карциномы горла и рта (FaDu, Cal27), карциномы молочной железы (MB231) и глиобластомы человека (U-118-MG);

2. Выявить, сопровождаются ли индуцируемые карнозином изменения пролиферации опухолевых клеток колебаниями внутриклеточного уровня АФК и антиоксидантных ферментов;

3. Выяснить, являются ли индуцируемые карнозином изменения пролиферации опухолевых клеток результатом модификации прогрессии клеточного цикла;

4. Сравнить антипролиферативные свойства карнозина с действием его производных.

5. Оценить эффект совместного применения карнозина и ионизирующего излучения на гибель опухолевых клеток.

Научная новизна. Настоящая работа представляет собой оригинальное экспериментальное исследование, в котором было впервые показано избирательное подавление пролиферации клеток глиобластомы под действием карнозина. Установлено, что замедление пролиферации глиобластомы сопровождается накоплением клеток в G2 фазе клеточного цикла и активацией экспрессии циклина B1. Продемонстрировано, что параллельно с изменениями в прогрессии клеточного цикла происходит повышение активности MnСОД и понижение внутриклеточного уровня АФК. Выявлено, что метилированное производное карнозина – анзерин – подавляет пролиферацию глиобластомы эффективнее, чем карнозин. Показано, что предварительная инкубация клеток с карнозином снижает выживаемость клеток глиобластомы под действием ионизирующего излучения.

Теоретическая и практическая значимость работы. Полученные результаты существенно расширяют представления о природе антипролиферативного действия карнозина на опухолевые клетки нейрального происхождения, что важно для понимания молекулярных механизмов действия карнозина в целом. Полученные в работе данные об эффекте совместного действия карнозина и ионизирующего излучения на выживаемость клеток глиобластомы открывают перспективу для применения карнозина в комбинированной терапии опухолей головного мозга.

Основные положения, выносимые на защиту:

1. Карнозин ингибирует пролиферацию опухолевых клеток нейрального происхождения, при этом наиболее выраженный эффект проявляется на клетках глиобластомы человека U-118-MG;

2. Ингибирование пролиферации клеток глиобластомы под действием карнозина сопровождается снижением уровня АФК и увеличением активности MnСОД;

3. Изменения в антиоксидантной системе клеток глиобластомы сопровождаются накоплением клеток в G2 фазе клеточного цикла и усилением экспрессии циклина В1;

4. Метилированное производное карнозина, анзерин, ингибирует пролиферацию клеток глиобластомы эффективнее, чем карнозин;

5. Предварительная инкубация клеток с карнозином снижает выживаемость клеток глиобластомы под действием ионизирующего излучения.

Протокол диссертационного исследования «Антипролиферативное действие карнозина и его производных на опухолевые клетки нейрального происхождения» был одобрен локальным этическим комитетом ФГБУ «НЦН» РАМН. Протокол №12/13 от 11 декабря 2013 г.

Апробация работы. Диссертация апробирована и рекомендована к защите на совместном заседании научных сотрудников ФГБУ «Научный центр неврологии» РАМН. Протокол № 11 от 18 октября 2013 г.

Материалы диссертационной работы были представлены на 2 международных конференциях: V Stromboli Conference on Cancer and Ageing: “The Primeval Life-Generating Molecules. Therapeutic and Aging-Reversing Properties” (Стромболи, Италия, 2010) и The 4th Quadrennial Meeting of the World Federation of Neuro-Oncology held in conjunction with the 2013 SNO Scientific Meeting and Education Day (Сан-Франциско, США, 2013)

Публикации. По материалам диссертации опубликовано 4 научные работы, из них 1 публикация в изданиях, рекомендуемых ВАК Министерства образования и науки РФ и 2 работы в зарубежных рецензируемых журналах.

Личный вклад автора. Автором лично выполнено культивирование клеточных линий и исследования клеточной пролиферации, проведено измерение уровня АФК, доли мертвых клеток, а также анализ клеточного цикла, определена активность и экспрессия антиоксидантных ферментов. Выполнена последующая аналитическая обработка и обобщение полученных результатов, сформулированы выводы и подготовлены публикации.

Структура и объем диссертации. Диссертация состоит из введения, обзора литературы, описания материалов и методов исследования, изложения результатов, их обсуждения, выводов и списка литературы. Работа содержит 120 стр. машинописного текста, 1 таблицу и 29 рисунков. Список литературы включает 271 источник (18 отечественных и 253 зарубежных).

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ.

Культуры клеток. В работе были использованы следующие клеточные линии: феохромоцитома крысы (РС-12); карцинома горла и рта (FaDu, Cal27), карцинома молочной железы (MB231) человека; глиобластома человека (U-118-MG). Клетки PC-12 культивировали в среде RPMI 1640 с добавлением HEPES, бикарбоната натрия, глутамина, гентамицина и эмбриональной телячьей сыворотки (ЭТС) (ПанЭко, Россия). Клетки FaDu и Cal27 культивировали в среде DMEM (Gibco, США) с добавлением ПенСтреп и ЭТС (HyClone, США). Клетки MB231 инкубировали в среде RPMI 1640 (Gibco, США) с добавлением ЭТС и ПенСтреп. Клетки U-118-MG культивировали в смеси DMEM:F12 (1:1) с добавлением HEPES, ПенСтреп, пирувата натрия (Gibco, США), инсулина (Sigma Aldrich, США), фактора роста фибробластов (Sigma Aldrich, США) и ЭТС. Клетки содержали в СО2-инкубаторе (ShelLab, США) в присутствии 5% СО2, 98% влажности и 37С.

Исследуемые соединения: Карнозин и гомокарнозин (чистота 99%) «Hamari Chem., LTD», анзерин (чистота 99%) «Yaizu Suisankagaku Industry Co.,Ltd.», N-ацетилкарнозин (чистота 98,7%) был синтезирован рутинным путем в лаборатории клинической и экспериментальной нейрохимии ФГБУ «НЦН» РАМН.

Исследование пролиферации клеток FaDu, Cal27, MB231 и U-118-MG, двухпараметрический анализ клеточного цикла, определение активности MnСОД, иммуноблоттинг, ПЦР в реальном времени были выполнены в лаборатории Доктора П.С. Госвами (P.C. Goswami) Университета Айовы (Айова Сити, США) в рамках стажировки по гранту Fulbright Foreign Student Program (№15121424).

Исследование клеточной пролиферации. Клетки высаживали в чашки Петри и каждые два дня считали их количество с помощью Z1 Coulter Counter (Beckman Coulter, США). Время удвоения популяции (doubling time, Тd) рассчитывали на экспоненциальном участке кривой роста по формуле: Тd=0.693t/ln(Nt/N0), где t – время (дни), N0 – начальное количество клеток, Nt – количество клеток ко дню t. Выживаемость рассчитывали как процентное соотношение эффективности посева (ЭП) в клетках, обработанных карнозином, к ЭП клеток в контроле.

Проточная цитометрия. Все измерения проводили на проточном цитометре FACSCalibur (BD, США), оснащенном ионным аргоновым лазером с длинной волны 488 нм и двумя светофильтрами: 585/42 нм для красной флуоресценции (PI) и 530/30 нм для зеленой флуоресценции (ФИТЦ, DCF). Из каждой пробы было проанализировано 10 000 событий.

Определение доли мертвых клеток. Клетки инкубировали с 1 мкМ йодида пропидия (PI) (Invitrogen, Germany) в течение 3 мин в темноте при комнатной температуре. Данные обрабатывали в программе Cell Quest Pro (BD, США) и рассчитывали среднее значение интенсивности флуоресценции в Microsoft Exel (Microsoft, США).

Измерение уровня АФК. Клетки инкубировали 30 мин в 100 мкМ 2,7-дихлордигидрофлуоресцеин-диацетат (DCFН2-DA) (Biotium, США) в темноте при 37оС. Данные обрабатывали в программе CellQuest Pro (BD, США). Результаты представлены в виде среднего значения интенсивности флуоресценции.

Анализ клеточного цикла. Фиксированные в 70% этаноле (- 4оС) клетки инкубировали РНКазой (Invitrogen, Germany) и PI (Invitrogen, Germany) в темноте. Данные обрабатывали с помощью программы ModFit LTTM(BD, США).

Двухпараметрический анализ клеточного цикла (Menon et al 2003, Sarsour et al 2005). Клетки инкубировали 30 мин с 5-бромдезоксиуридином (БДУ) (37 оС) и фиксировали в 70% этаноле (- 4оС). Фиксированные клетки инкубировали в пепсине, нейтрализовали в боратном буфере, центрифугировали, осадок инкубировали с мышиными антителами против БДУ (1:10, BD, США), и затем с антимышиными козьими ФИТЦ-коньюгированными антителами (1:10, BD, США). Далее подготавливали клетки для анализа клеточного цикла по протоколу, описанному выше. Данные обрабатывали в программе FlowJo v8.8.7.

Иммуноблоттинг. Для выделения белков клетки разрушали с помощью ультразвука в лизирующем буфере, содержащем фосфатный буфер (pH 7.8), ингибитор фосфатаз (PhosSTOP, Roche, США), коктейль ингибиторов протеаз (Sigma, США), 2% NP-40 и ДНКазу (0.01 ед/мкл, Zimo Research Corp., США). Белки разделяли в 12% полиакриламидном геле в присутствии додецилсульфата натрия и переносили с помощью полусухого электротранспорта на нитроцеллюлозную мембрану. Мембраны инкубировали с антителами против MnСОД (1:1000, Millipore, США), циклина B1 (1:1000, BD, США), НАДФН (1:500, BD, США) и актина (1:1000, Millipore, США). В качестве вторичных антител были использованы: меченные пероксидазой хрена антимышиные овечьи антитела (1:5000, GE Healthcare, США) и антикроличьи ослиные антитела (1:10,000, GE Healthcare, США). Иммунореактивные полоски визуализировали с помощью набора Pierce ECL 2 Western Blotting Substrate (Thermo Scientific, США) согласно инструкции производителя и детектировали с помощью Typhoon FLA 7000 (General Electric, США). Интенсивность полос анализировали в программе ImageJ (NIH, США). Нормирование количества белка проводили на уровень актина и НАДФН.

Определение активности MnСОД. Нативный белок разделяли c помощью неденатурирующего электрофореза в 12.5% полиакриламидном геле. Активность MnСОД определяли по методу предложенному ранее (Sarsour et al 2008, Weydert et al 2003). Гель сканировали с помощью Epson Perfection 4990 PHOTO и анализировали интенсивность полос в программе ImageJ (NIH, США).

ПЦР в реальном времени. РНК выделяли с помощью набора «Direct-zolTM RNA MiniPrep Kit», согласно инструкции производителя (Zimo Research Corp., США). Комплементарную ДНК синтезировали с помощью набора «High Capacity cDNA Reverse Transcription Kit» (Applied Biosystems, США). Измерение уровня РНК проводили с помощью метода ПЦР в реальном времени (Applied Biosystems, США), используя последовательности праймеров, представленных в Таблице 1. Данные анализировали в программе StepOne Software v2.2 (Applied Biosystems, США) и Microsoft Excel (Microsoft, США). Результаты представлены в виде значений относительной экспрессии (2CT).

Ген Gene Bank No. Последовательность (5 3) Размер ампликона (п.о.)
CCNB1 (циклин В1) NM_031966.3 Forward: TAGCACTGAAAATTCTGGATAATGGTGA Reverse: TTGATTTACCATGACTACATTCTTAGCCAG 125
ACTB (актин В) NM_001101.3 Forward: TCACCATTGGCAATGAGCGGTT Reverse: AGTTTCGTGGATGCCACAGGACT 89
CRNS1 (карнозин-синтетаза) NM_001166222.1 Forward: AAGCTGGAGGAGGAGGAGAGTGTC Reverse: CCTTGCTCAGCAGTGGCCTATCA 154
CNDP1 (карнозиназа) NM_032649 Forward: CAGCAATCACTTACGGAACCCG Resverse: CCGAGAAGAGCAACCAGATCAGC 133
MnСОД NM_000636.2 Forward: TTGGCCAAGGGAGATGTTAC Reverse: AGTCACGTTTGATGGCTTCC 157

Статистическая обработка результатов. Результаты измерений, проведенных в 3-5 параллельных пробах, представлены в виде «среднее значение ± стандартное отклонение». Статистическая значимость определяли с помощью одномерного дисперсионного анализа с последующим тестом на наименьшую значимую разность и тестом на взвешенное среднее Тьюки. Данные тесты используются для сравнения и определения разницы между и в пределах групп данных в зависимости от значений среднего и среднеквадратических ошибок для каждой переменной. Гомогенность дисперсии бралась в пределах доверительного интервала в 95%. Результаты со значениями р<0.05 принимались как статистически значимые.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ

РАЗДЕЛ 1. Изучение характера действия карнозина на пролиферацию опухолевых клеток нейрального происхождения

1.1. Карнозин снижает количество клеток РС-12 в культуре

Для изучения действия карнозина на пролиферацию клеток РС-12, в среду культивирования добавляли карнозин (10 - 50 мМ) и инкубировали в течение 48 ч. Подсчет общего количества клеток в каждой пробе выявил, что карнозин индуцирует дозозависимое снижение общего количества клеток РС-12 (Рис. 1.А). Инкубация с 10 мМ карнозина приводила к снижению количества клеток в пробе до 69% относительно контроля, с 25 мМ – до 52%, с 50 мМ – до 45% (Рис. 1.А). Подсчет количества некротических клеток не выявил достоверных различий между пробами, обработанными карнозином, и контролем (Рис. 1.Б). Исходя из полученных данных, был сделан вывод о том, что снижение общего количества клеток РС-12 под действием карнозина не связано с их гибелью по пути некроза.

Рисунок 1. Карнозин снижает количество клеток РС-12 в культуре. Клетки обрабатывали карнозином (10 - 50 мМ) в течение 48 ч. (А) Общее количество клеток, подсчитанное в камере Горяева. (Б) Процент погибших клеток, определенный с помощью проточного цитометра по количеству клеток, меченных PI. Звездочка обозначает статистически значимое отличие от количества клеток в контроле; n=3, p<0.05.

 1.2. Карнозин снижает уровень АФК в клетках культуры РС-12 -1

1.2. Карнозин снижает уровень АФК в клетках культуры РС-12

Рисунок 2. Карнозин снижает уровень АФК в клетках РС-12. Клетки инкубировали с 50 мМ карнозина в течение 0,5 - 48 ч. Уровень АФК измеряли с помощью метода проточной цитометрии по степени окисления флуоресцентного красителя DCFH2-DA. Звездочка обозначает статистически значимое отличие от уровня АФК в контроле; n=3, p<0.05.

Для того чтобы выяснить, сопровождается ли снижение количества клеток изменениями внутриклеточного уровня АФК, клетки обрабатывали карнозином (50 мМ) в течение 0,5 - 48 ч и измеряли уровень АФК. Как следует из Рис. 2, уже через 30 мин инкубации уровень АФК в пробах с карнозином снижался на 50% по сравнению с контролем. Пониженный уровень АФК поддерживался в течение 24 ч и возвращался к контрольному уровню через 48 ч. Полученные данные согласовывались с результатами работы Iovine et al (2012), где было показано, что снижение количества клеток карциномы прямой кишки HCT116 под действием карнозина также сопровождается понижением уровня АФК.

1.3. Карнозин индуцирует накопление клеток РС-12 в S и G2/М фазах клеточного цикла

Для того чтобы выяснить, является ли индуцируемое карнозином снижение количества клеток РС-12 результатом изменений в прогрессии клеточного цикла, клетки РС-12 обрабатывали карнозином (10 - 50 мМ) в течение 48 ч и затем измеряли распределение клеток по фазам клеточного цикла.

Рисунок 3. Карнозин индуцирует накопление клеток РС-12 в S и G2/М-фазах клеточного цикла. Клетки РС-12 инкубировали с карнозином (5 - 50 мМ) в течение 48 ч. Содержание ДНК измеряли на проточном цитометре по интенсивности флуоресценции PI. (А) Пример распределения клеток по фазам клеточного цикла в контроле и после инкубации с 50 мМ карнозина. (Б) Процентное распределение клеток по фазам клеточного цикла в контроле и после обработки карнозином. Звездочка обозначает статистически значимое отличие от количества клеток в контроле; n=3, p<0.05.

На Рис. 3.А. представлен пример распределения клеток между G0/G1, S и G2/М фазами в контроле и после инкубации с 50 мМ карнозина. Как следует из Рис. 3.А, карнозин увеличивал количество клеток в S и G2/M фазах клеточного цикла, количество G0/G1 клеток при этом снижалось. Увеличения количества апоптотических клеток под действием карнозина выявлено не было. Увеличение концентрации дипептида способствовало усилению эффекта (Рис. 3.Б). Достоверно отличимый от контроля результат был получен при концентрациях 25 - 50 мМ карнозина. В пробах, обработанных 50 мМ карнозина, число S и G2/M клеток возрастало, соответственно, до 15% и 22%, по сравнению с 12% и 17% в контроле. Количество G0/G1 клеток при этом снижалось до 62% по сравнению с 71% в контроле. Исходя из полученных данных, был сделан вывод о том, что снижение количества клеток РС-12 под действием карнозина происходит в результате замедления прогрессии клеточного цикла и накопления клеток в S и G2/М фазах.Таким образом, мы показали, что уменьшение общего количества клеток РС-12 в культуре под действием карнозина сопровождается снижением внутриклеточного уровня АФК и накоплением клеток S и G2/М фазах клеточного цикла. Известно, что продвижение клеток от G1 фазы клеточного цикла к митозу сопровождается повышением уровня АФК. Клетки, находящиеся в S и в G2 фазах, демонстрируют более высокий уровень АФК по сравнению с клетками в G1 фазе (Goswami et al 2000). Следовательно, можно предположить, что снижение уровня АФК под действием карнозина нарушает прогрессию клеточного цикла, приводя к замедлению пролиферации клеток РС-12.

РАЗДЕЛ 2. Изучение механизма действия карнозина на регуляцию клеточного цикла.

Исследования механизма антипролиферативного эффекта карнозина были продолжены с использованием культур опухолевых клеток человека, так как именно они имеют перспективу применения полученных данных на практике.

2.1. Карнозин селективно ингибирует пролиферацию клеток глиобластомы

Для изучения характера действия карнозина на пролиферацию клеток карциномы горла и рта (FaDu, Cal27), молочной железы (MB231) и глиобластомы (U-118-MG) человека к среде культивирования добавляли карнозин (40 мМ) и оставляли инкубироваться. Каждые два дня в течение 6 дней клетки подсчитывали и вычисляли время удвоения популяции (Td). Как следует из Рис. 4, карнозин приводил к увеличению Td всех исследованных клеточных линий. Для интактных клеток Td составляло: 18 ч (FaDu), 16 ч (Cal27), 22 ч (MB231) и 24 ч (U-118-MG). После инкубации с карнозином Td возрастало до: 19 ч (FaDu), 18 ч (Cal27), 26 ч (MB231) и 32 ч (U-118-MG). Увеличение Td под действием карнозина свидетельствовало о замедлении процессов клеточной пролиферации. Наибольшее увеличение Td было отмечено в клетках U-118-MG (Рис. 4).

Рисунок 4. Карнозин избирательно ингибирует пролиферацию клеток глиобластомы. К среде культивирования добавляли карнозин (40 мМ) и оставляли инкубироваться. Каждые два дня в течение 6 дней клетки считали и вычисляли Td. Звездочка обозначает статистически значимое отличие от Td в клетках той же линии необработанных карнозином; n=3, p<0.05.

Неоднозначность в действии карнозина на опухолевые клетки могла быть связана с различиями в экспрессии внутриклеточных ферментов, отвечающих за синтез и разрушение карнозина. С помощью метода ПЦР в реальном времени было обнаружено, что уровень мРНК карнозин-синтазы в клетках глиобластомы был в 3,5 - 5 раз ниже, чем в клетках карцином (Рис. 5.А), а уровень мРНК карнозиназы, наоборот, был в 4 - 6 раз выше (Рис. 5.Б). На основании этих данных можно предположить, что уровень эндогенного карнозина в клетках глиобластомы изначально ниже, чем в клетках карцином.

Рисунок 5. Экспрессия карнозин-синтезирующих и карнозин-разрушающих ферментов в исследуемых клеточных культурах. Результаты анализа ПЦР в реальном времени уровня мРНК карнозин-синтетазы (А) и карнозиназы (Б). Звездочка обозначает статистически значимое отличие от уровня мРНК в клетках U-118-MG; n=3, p<0.05.

Изначально низкий уровень карнозина в клетках глиобластомы, вероятно, обуславливает их большую чувствительность к антипролиферативному эффекту карнозина, в то время как высокий уровень карнозина в клетках карцином способствует развитию в них толерантности к рост-ингибирующему действию карнозина. Поскольку наиболее выраженный антипролиферативный эффект карнозина был получен на клетках глиобластомы человека U-118-MG, эти клетки были использованы в дальнейших исследованиях.

Для более подробного изучения антипролифативного действия карнозина, клетки U-118-MG инкубировали в среде, в которую добавляли 20-100 мМ карнозина и измеряли Td. Было выявлено, что карнозин приводит к дозо-зависимому увеличению Td клеток U-118-MG (Рис. 6.А), что согласовывалось с полученными ранее данными (Рис. 4). Td в контроле составляло 35 ч, в присутствии 50 мМ карнозина Td увеличивалось до 66 ч. Пролиферация была полностью подавлена в пробах, обработанных 80 мМ и 100 мМ карнозина. Ингибирующий эффект карнозина на пролиферацию клеток U-118-MG был подтвержден результатами измерения способности клеток формировать колонии. Выживаемость клеток, обработанных 100 мМ карнозина, снижалась до 60% по сравнению с контролем (Рис. 6.Б).

Рисунок 6. Карнозин дозо-зависимо подавляет пролиферацию клеток глиобластомы. (А) Кривые роста клеток U-118-MG в контроле и при добавлении к среде культивирования 20 – 100 мМ карнозина. Td рассчитывали, как описано на Рис. 4. Звездочка обозначает статистически значимое отличие от количества клеток в контроле; n=3, p<0.05. (Б) Выживаемость клеток, измеренная по способности формировать колонии. Звездочка обозначает статистически значимое отличие от выживаемости в контроле; n=3, p<0.05.

2.2. Карнозин снижает уровень АФК и индуцирует экспрессию MnСОД

Для того чтобы выяснить, связано ли замедление пролиферации под действием карнозина с изменениями внутриклеточного уровня АФК, клетки обрабатывали карнозином (50 - 100 мМ) в течение 24 ч и с помощью проточной цитометрии измеряли уровень АФК. Как следует из Рис. 7, карнозин приводил к дозо-зависимому снижению уровня АФК в клетках U-118-MG, что согласовывалось с данными, полученными ранее на клетках РС-12 (Рис. 2), и подтверждало предположение о том, что антипролиферативый эффект карнозина обусловлен его антиоксидантными свойствами.

Рисунок 7. Карнозин снижает уровень АФК в клетках U-118-MG. Клетки обрабатывали карнозином (50 - 100 мМ) в течение 24 ч. Уровень АФК измеряли, как описано на Рис. 2. Результаты представлены в виде среднего значения флуоресценции, рассчитанного относительно контроля. Звездочка обозначает статистически значимое отличие от уровня АФК в контроле; n=3, p<0.05.

Для изучения эффекта карнозина на антиоксидантную систему клеток U-118-MG измеряли активность одного из основных ферментов внутриклеточной системы антиоксидантов – митохондриальной изоформы супероксиддисмутазы (MnСОД). С помощью метода неденатурирующего гель-электрофореза было обнаружено, что активность MnСОД в клетках, обработанных карнозином (50 - 100 мМ), была в 3,3 - 3,6 раз выше, чем в контроле (Рис. 8.А). Отсутствие изменений в активности цитозольной изоформы супероксиддисмутазы (CuZnСОД) (Рис. 8.А) позволяет предположить, что антипролиферативный эффект карнозина связан со снижением уровня АФК, генерируемых в митохондриях. Повышение активности MnСОД сопровождалось соответствующим увеличением уровня белка и мРНК MnСОД (Рис. 8.Б,Г). Увеличение уровня белка MnСОД начиналось через 16 ч после добавления 50 мМ карнозина (Рис. 8.В). Известно, что интенсивность пролиферации зависит от активности MnСОД: повышение активности MnСОД ингибирует клеточный рост, в то время как понижение активности MnСОД усиливает пролиферацию (Chaudhuri et al 2012, Sarsour et al 2012, Sarsour et al 2013). Исходя из полученных нами результатов и данных литературы, можно предположить, что антипролиферативный эффект карнозина обусловлен его способностью усиливать активность и экспрессию MnСОД и снижать уровень АФК.

Рисунок 8. Карнозин индуцирует экспрессию MnСОД в клетках U-118-MG. Клетки обрабатывали карнозином (25 - 100 мМ) в течение 24 ч. (А) Активность MnСОД, определенная с помощью метода белкового электрофореза в неденатурирующем геле. (Б, В) Уровень белка MnСОД, измеренный методом иммуноблоттинга, актин использовали для нормирования количества белка. (Г) Уровень мРНК MnСОД, измеренный с помощью метода ПЦР в реальном времени. Звездочка обозначает статистически значимое отличие от уровня мРНК в контроле; n=3, p<0.05.

2.3. Карнозин индуцирует G2 блок и усиливает экспрессию циклина В1

Для того чтобы выяснить, является ли антипролиферативный эффект карнозина результатом изменений в прогрессии клеточного цикла, клетки U-118-MG обрабатывали карнозином (20 – 100 мМ) в течение 24 ч и измеряли количество клеток в G1, S и G2 фазах. На Рис. 9.А. представлен типичный пример распределения клеток U-118-MG по фазам клеточного цикла в контроле и после инкубации с карнозином. Как следует из Рис. 9, инкубация с карнозином (20 - 100 мМ) приводила к дозо-зависимому увеличению количества клеток в G2 фазе, что сопровождалось соответствующим уменьшением числа клеток в S фазе. Распределение в контроле было следующим: G1 - 39%, S - 44% и G2 - 17% клеток (Рис. 9.Б). Достоверно отличимый от контроля результат был получен в пробах, обработанных карнозином в концентрации 80 - 100 мМ. Количество клеток в G2 фазе увеличивалось до 39% относительно 17% в контроле, количество клеток в S фазе уменьшалось до 22% относительно 44% в контроле (Рис. 9.Б). Наши данные согласуются с результатами, полученными ранее в работах Renner et al (2008, 2010), демонстрирующими снижение количества митозов и скорости синтеза ДНК в клетках, обработанных карнозином. Исходя из имеющихся данных, был сделан вывод о том, что ингибирующий эффект карнозина на пролиферацию клеток глиобластомы обусловлен нарушением прогрессии клеточного цикла через G2 фазу.

 Карнозин индуцирует G­2 блок в клетках U-118-MG. Клетки-8

Рисунок 9. Карнозин индуцирует G­2 блок в клетках U-118-MG. Клетки инкубировали с карнозином (20 – 100 мМ) в течение 24 ч, метили 5-бромдезоксиуридином (БДУ) и считали количество БДУ-положительных (S фаза) и БДУ-отрицательных (G1 и G2 фазы) клеток на проточном цитометре. (А) Пример распределения клеток U-118-MG по фазам клеточного цикла. (Б) Процентное распределение клеток по фазам клеточного цикла в контроле и после инкубации с карнозином. Звездочка обозначает статистически значимое отличие от количества клеток в контроле; n=3, p<0.05.

Прохождение клетки через фазы клеточного цикла регулируется последовательной экспрессией циклинов. Циклин В1 специфически экспрессируется во время G2 фазы (Grana and Reddy 1995). Было показано, что индукция G2 блока в присутствии некоторых антиоксидантов, например, витамина С, сопровождается усилением экспрессии циклина В1 (Thomas et al 2005). Для того чтобы определить, связано ли индуцированное карнозином накопление клеток в G2-фазе с изменениями экспрессии циклина В1, клетки U-118-MG обрабатывали 50 и 100 мМ карнозина в течение 24 ч и измеряли уровень белка и мРНК циклина В1. С помощью метода иммуноблоттинга было выявлено, что обработка клеток глиобластомы карнозином (50 – 100 мМ) индуцирует увеличение количества белка циклина В1 в 2,5 – 4 раза (Рис. 10.А). Повышение уровня белка циклина В1 было сопряжено с увеличением уровня мРНК (Рис. 10.В).

 Карнозин усиливает экспрессию циклина B1 в клетках U-118-MG.-9

Рисунок 10. Карнозин усиливает экспрессию циклина B1 в клетках U-118-MG. Клетки инкубировали с карнозином (50 - 100 мМ) в течение 2 - 24 ч. (А, Б) Иммуноблот. (В) Результаты ПЦР в реальном времени. Звездочка обозначает статистически значимое отличие от уровня мРНК в контроле; n=3, p<0.05.

Резюмируя вышесказанное, в данной работе было впервые показано, что замедление пролиферации клеток глиобластомы под действием карнозина сопровождается снижением внутриклеточного уровня АФК, усилением экспрессии MnСОД и циклина В1, а также накоплением клеток в G2 фазе клеточного цикла. Известно, что по мере прогрессии клеточного цикла от G1 фазы к митозу (М) происходит снижение активности MnСОД, что совпадает с увеличением внутриклеточного уровня АФК и усилением пролиферации (Goswami et al 2000, Sarsour et al 2012). Усиление экспрессии MnСОД в клетках карциномы рта и поджелудочной железы усиливало формирование G2-блока под действием ионизирующего излучения (Kalen et al 2006, Fisher and Goswami 2008). Следовательно, можно предположить, что по мере прогрессии через G2 фазу и М внутриклеточный редокс-статус смещается в более окисленное состояние (Goswami et al 2000). Снижение уровня АФК и усиление экспрессии MnСОД под действием карнозина, вероятно, препятствует смещению редокс окисленное состояние, способствуя формированию G2-блока. Интересно отметить, что увеличение уровня белка циклина В1 совпадало по времени с ростом уровня MnСОД и происходило спустя 16 часов после добавления 50 мМ карнозина (Рис. 10.Б и 8.В). Это еще раз указывает на существование взаимосвязи между активацией MnСОД и регуляцией клеточного цикла.

РАЗДЕЛ 3. Сравнение антипролиферативного эффекта карнозина на клетки глиобластомы с действием его производных

У карнозина существует несколько природных производных, среди них: ацетил-карнозин (N-ацетил--аланил-L-гистидин), анзерин (-аланил-3-метил-L-гистидин), гомокарнозин (у-амино-бутирил-L-гистидин). Для оценки вовлеченности отдельных групп молекулы карнозина в антипролиферативный эффект, действие карнозина сравнивали с эффектом его производных. К среде культивирования клеток U-118-MG добавляли исследуемые соединения в концентрации 40 мМ и оставляли на инкубацию. Каждые два дня в течение 6 дней клетки считали и вычисляли Td (Рис. 11).

Рисунок 11. Анзерин ингибирует пролиферацию клеток глиобластомы U-118-MG эффективнее, чем другие производные карнозина. К среде культивирования добавляли дипептиды в концентрации 40 мМ и оставляли инкубироваться. Каждые два дня в течение 6 дней клетки считали и вычисляли Td. Звездочка обозначает статистически значимое отличие от Td в контроле; n=3, p<0.05.

Как следует из Рис. 11, все исследованные дипептиды приводили к удлинению Td, однако в разной степени, что свидетельствует о существовании взаимосвязи между структурой дипептида и эффективностью ингибирования пролиферации. Как следует из Рис. 11, ацетил-карнозин обладал наименее выраженным эффектом, увеличивая Td клеток глиобластомы на 3 ч по сравнению с контролем. Td клеток, обработанных гомокарнозином и карнозином, было примерно одинаковым и превышало контрольное значение на 6 - 7,5 ч. Анзерин ингибировал пролиферацию сильнее, чем остальные соединения. Td клеток, обработанных анзерином, было на 12 ч дольше по сравнению с контролем. Исходя из полученных результатов, был сделан вывод о том, что метилирование молекулы карнозина в положении 1N имидазольного кольца усиливает ингибирующий эффект на пролиферацию клеток глиобластомы.

РАЗДЕЛ 4. Эффект совместного применения карнозина и радиотерапии.

На сегодняшний день лучевая терапия - один из наиболее эффективных способов лечения глиобластомы. Для того чтобы исследовать последствия совместного применения карнозина и ионизирующего излучения, клетки обрабатывали карнозином (100 мМ) в течение 24 ч, облучали (4 Гр) и рассаживали для формирования колоний. На Рис. 12.А. представлены примеры колоний в чашках Петри, сформированных в контроле, после инкубации с карнозином и действия облучения. Подсчет количества колоний и расчет выживаемости показали, что инкубация клеток с 100 мМ карнозина приводит к снижению выживаемости клеток глиобластомы до 53% по сравнению с контролем (Рис. 12.Б). Облучение клеток при 4 Гр снижало выживаемость на 67%. Выживаемость клеток, подвергнутых совместному действию карнозина и ионизирующего излучения, составляло 17% от контроля. Таким образом, было продемонстрировано, что предварительная инкубация с карнозином снижает выживаемость клеток глиобластомы под действием ионизирующего излучения.

Рисунок 12. Предварительная инкубация с карнозином усиливает гибель клеток глиобластомы под действием ионизирующего облучения. Клетки инкубировали с карнозином (100 мМ) в течение 24 ч, облучали при 4 Гр и рассеивали в низких разведениях для формирования колоний. (А) Пример колоний, сформированных в контроле, после обработки карнозином и облучения. (Б) Выживаемость клеток, измеренная по способности формировать колонии. Звездочки обозначают статистически значимое отличие от значения выживаемости в контроле (*) или от проб, облученных при 4 Гр (**); n=3, p<0.05.

ВЫВОДЫ

1. Исследован характер воздействия карнозина на пролиферацию культур опухолевых клеток: феохромоцитомы крысы (РС-12), карциномы горла и рта (FaDu и Cal27), карциномы молочной железы (MB231) и глиобластомы человека (U-118-MG). Обнаружено, что карнозин ингибирует пролиферацию всех исследованных клеточных линий. Наиболее выраженный эффект проявлялся на клетках глиобластомы человека U-118-MG;

2. Изучено влияние карнозина на уровень АФК и активность антиоксидантных ферментов глиобластомы. Выявлено, что ингибирование пролиферации клеток глиобластомы под действием карнозина сопровождается снижением уровня АФК и увеличением активности MnСОД;

3. Исследовано воздействие карнозина на клеточный цикл клеток РС-12 и U-118-MG. Установлено, что изменения в антиоксидантной системе сопровождаются накоплением клеток в G2 фазе клеточного цикла и усилением экспрессии циклина В1;

4. Проведено сравнение антипролиферативного эффекта карнозина с действием его производных. Выявлено, что метилированное производное карнозина, анзерин, ингибирует пролиферацию опухолевых клеток эффективнее, чем карнозин;

5. Исследован эффект совместного применения карнозина и ионизирующего излучения на гибель опухолевых клеток. Обнаружено, что предварительная инкубация клеток с карнозином снижает выживаемость клеток глиобластомы под действием ионизирующего излучения.

СПИСОК НАУЧНЫХ РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

Работы, опубликованные в ведущих рецензируемых журналах, определенных ВАК РФ:

  1. Рыбакова Ю.С., Болдырев А.А. «Влияние карнозина и родственных соединений на пролиферацию клеток культуры феохромоцитомы крысы РС-12». // Клеточные технологии в биологии и медицине. 2012; 3: 143-148. (0,52 печ.л.).

Другие издания:

  1. Khavinson V, Rybakova Y, Kulebiakin K, Vladychenskaya E, Kozina L, Arutjunyan A, Boldyrev A. “Pinealon increases cell viability by suppression of free radical levels and activating proliferative processes”.// Rejuvenation Research, 2011;14(5): 535-541. (0,81 печ.л.).
  2. Rybakova Y, Akkuratov E, Kulebyakin K, Brodskaya O, Dizhevskaya A, Boldyrev A. “Receptor-mediated oxidative stress in murine cerebellar neurons is accompanied by phosphorylation of MAP (ERK 1/2) kinase”// Current Aging Science 2012;5(3):225-230. (0,69 печ.л.).

Материалы научных конференций:

  1. Rybakova Y., Akkuratov E., Kulebyakin K., Brodskaya O., Dizhevskaya A., Boldyrev A. “Receptor mediated oxidative stress in murine cerebellar neurons is accompanied by phosphorylation of MAP (ERK 1/2) kinase”. // V Stromboli Conference on Cancer and Ageing: “The Primeval Life-Generating Molecules. Therapeutic and Aging-Reversing Properties”, p. 40. (0,06 печ.л.).

СПИСОК ИСПОЛЬЗОВАННЫХ СОКРАЩЕНИЙ

АФК БДУ ДНК ДНКаза мРНК НАДФН ПЦР РНК РНКаза СОД Td ФИТЦ ЭП ЭТС DCFH2-DA PI Cal27 FaDu HeLa MRC-5 U-118-MG РС-12 ЭСК ЭТК - - - - - - - - - - - - - - - - - - - - - Активные формы кислорода 5-бромдезоксиуридин Дезоксирибонуклеиновая кислота Дезоксирибонуклеаза Матричная РНК Никотинамидадениндинуклеотидфосфат Полимеразная цепная реакция Рибонуклеиновая кислота Рибонуклеаза Супероксид дисмутаза Время удвоения популяции Изотиоционат флуоресцеина Эффективность посева Эмбриональная телячья сыворотка 2,7-дихлордигидрофлуоресцеин-диацетат Пропидий йодид Клетки карциномы молочной железы человека Клетки карциномы горла и рта человека Клетки карциномы шейки матки человека Нормальные человеческие фибробласты Клетки глиобластомы человека Клетки феохромоцитомы крысы Эмбриональные стволовые клетки человека Клетки эмбриональной терато-карциномы человека


 



<
 
2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.