WWW.DISUS.RU

БЕСПЛАТНАЯ НАУЧНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

Изучение связи полиморфизмов гена секреторной фосфолипазы а2 группы iiа с ее уровнем и активностью, а также с наличием и выраженностью атеросклероза коронарных артерий

На правах рукописи

Павлунина Татьяна Олеговна

Изучение связи полиморфизмов гена секреторной фосфолипазы А2 группы IIА с ее уровнем и активностью, а также с наличием и выраженностью атеросклероза коронарных артерий

14.01.05 – кардиология

03.01.04 – биохимия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата медицинских наук

Москва – 2013

Работа выполнена в отделе проблем атеросклероза НИИ кардиологии им. Мясникова, лаборатории медицинской генетики ИКК им. А.Л. Мясникова и лаборатории биохимической инженерии института экспериментальной кардиологии ФГБУ «РКНПК» МЗ РФ

Научные руководители:

Доктор медицинских наук Каминный Александр Иванович

Доктор биологических наук Коротаева Александра Алексеевна

Официальные оппоненты:

Доктор медицинских наук, профессор, научный руководитель, руководитель Центра диагностики и инновационных медицинских технологий ЗАО Группа компаний «Медси» Коновалов Геннадий Александрович
Доктор медицинских наук, профессор, ведущий научный сотрудник отдела сердечно-сосудистой патологии, лаборатории биохимии и свободно-радикальных процессов Института клинической кардиологии ФГБУ «Российский кардиологический научно-производственный комплекс» МЗ РФ Тихазе Алла Карловна

Ведущая организация: ГБОУ ВПО «Московский государственный медико-стоматологический университет» МЗ РФ

Защита состоится « » 2013г. в 13:30 на заседании диссертационного совета Д 208.073.04 по присуждению ученой степени кандидата в ФГБУ «Российский кардиологический научно-производственный комплекс» МЗ РФ (121552 Москва, ул. 3-я Черепковская д. 15а)

С диссертацией можно ознакомиться в библиотеке ФГБУ «РКНПК» МЗ РФ.

Автореферат разослан « » 2013 года

Ученый секретарь диссертационного совета, к.м.н. Полевая Т.Ю.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы: Атеросклероз является заболеванием, в патогенезе которого важную роль играет воспаление, что подтверждается наличием циркулирующих в крови провоспалительных маркеров, повышенный уровень которых ассоциирован с увеличением риска сердечно-сосудистых осложнений. Одним из таких провоспалительных маркеров является секФЛА2-IIА. В ряде исследований показано, что секФЛA2-IIA может играть важную роль в развитии атеросклероза. Вместе с тем, высокий уровень секФЛА2-IIА также считается предиктором возникновения неблагоприятных сердечно-сосудистых событий у пациентов с острым коронарным синдромом (Kugiyama et al.,2000) и стабильным течением ИБС (Koenig et al., 2009).

В тоже время, известно, что развитие атеросклероза является результатом комплексного влияния различных факторов риска, таких как, гиперхолестеринемия, курение, артериальная гипертензия, наследственность, и вполне вероятно, что секФЛA2-IIA может рассматриваться как дополнительный фактор риска. Ранее проведен ряд исследований, показавших, что активность и уровень секФЛА2-IIA генетически детерминированы и полиморфизмы гена секФЛА2-IIA ассоциированы с развитием сердечно-сосудистых осложнений (Koenig et al., 2009; Simon et al., 2008; Wootton et al., 2006). Следует отметить, что большинство исследований проведено у больных с ОКС и с относительно стабильным течением ИБС. Изучена связь полиморфизмов гена секФЛА2-IIA с уровнем и активностью секФЛА2-IIA, а также с сердечно-сосудистыми событиями у пациентов с ОКС, но в тоже время, недостаточно изучена связь уровня и активности секФЛА2-IIA со степенью поражения коронарных артерий, при этом связь полиморфизмов гена секФЛА2-IIA со степенью выраженности коронарного атеросклероза не изучалась. Именно поэтому довольно актуальным является комплексное изучение связи полиморфизмов генов секФЛА2-IIA с уровнем и активностью секФЛА2-IIA, а также со степенью поражения коронарного русла у больных со стабильным течением ИБС.

Цель исследования:

Изучить связь полиморфизмов гена секреторной фосфолипазы А2 группы IIА с её уровнем и каталитической активностью, а также с наличием и выраженностью атеросклероза коронарных артерий.

Задачи исследования:

1. Определить уровень и активность секФЛА2-IIА у больных с коронарным атеросклерозом и ангиографически неизмененными коронарными артериями и проанализировать их ассоциацию с наличием коронарного атеросклероза.

2. Определить степень выраженности атеросклеротического поражения коронарных артерий у пациентов с помощью индекса Gensini score и проанализировать ее связь с традиционными факторами риска, а также с секФЛА2-IIА.

3. Определить генотипы полиморфизмов гена секФЛА2-IIА (PLA2G2A) -655T/C, 763C/G, 1022G/T, 4982T/A, 5128T/G, проанализировать их ассоциацию с уровнем и активностью секФЛА2-IIА, а также с наличием и выраженностью коронарного атеросклероза.

4. Провести анализ ассоциации гаплотипов полиморфизмов гена секФЛА2-IIА: -655T/C, 763C/G, 1022G/T, 4982T/A, 5128T/G с уровнем и активностью секФЛА2-IIА, наличием и выраженностью коронарного атеросклероза.

Научная новизна:



Впервые проведена комплексная оценка влияния функциональных полиморфизмов гена секФЛА2-IIA на уровень и активность секФЛА2-IIA, а также наличие и выраженность атеросклероза коронарных артерий в группах пациентов с коронарным атеросклерозом и ангиографически неизмененными коронарными артериями. Впервые у пациентов российской популяции показано, что полиморфизмы -655T/C и 763C/G ассоциированы с повышением уровня секФЛА2-IIA, полиморфизмы 1022G/T и 5128T/G – со снижением уровня секФЛА2-IIА, при этом каждый отдельно проанализированный полиморфизм не был ассоциирован с наличием коронарного атеросклероза и степенью его выраженности. В данном исследовании впервые показано, что гаплотип CGGTT независимо ассоциирован с самым высоким уровнем секФЛА2-IIА и по сравнению с ним все редко встречаемые гаплотипы ассоциированы с меньшим риском коронарного атеросклероза. Выявлена ассоциация повышенного уровня и активности секФЛА2-IIА с наличием коронарного атеросклероза. Впервые оценена связь уровня и активности секФЛА2-IIA со степенью выраженности коронарного атеросклероза с использованием индекса Gensini score.

Практическая значимость работы:

  1. Функциональные полиморфизмы гена секФЛА2-IIA могут как повышать, так и понижать уровень секФЛА2-IIA. Поэтому для оценки их суммарного действия необходимо определение их сочетанного наследования у каждого пациента.
  2. Повышенные уровень и активность секФЛА2-IIA ассоциированы с наличием коронарного атеросклероза, что позволяет их рассматривать в качестве возможных маркеров атеросклероза.

Внедрение результатов исследования: Результаты исследования используются в практической работе отдела атеросклероза НИИ кардиологии им. А.Л. Мясникова ФГБУ «РКНПК» МЗ РФ.

Апробация работы и публикации: Апробация диссертации состоялась 15 января 2013 года на заседании межотделенческой конференции НИИ кардиологии им. А.Л. Мясникова ФГБУ «РКНПК» МЗ РФ. По теме диссертации опубликовано 6 работ, из них 3 статьи в журналах рекомендованных ВАК РФ.

Объем и структура диссертации: Диссертация изложена на 102 стр., состоит из 4 глав и разделов «Введение», «Выводы» и «Практические рекомендации», содержит 14 таблиц и 22 рисунков. Список использованной литературы содержит 161 источник.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

В исследование включались пациенты мужского и женского пола, имеющие показания для проведения рентгеноконтрастной коронарной ангиографии.

В исследование не включались пациенты, перенесшие острый коронарный синдром менее чем за 6 месяцев до начала исследования, подвергшиеся оперативному вмешательству в сроки менее чем за 6 месяцев до начала исследования, пациенты с заболеваниями воспалительного характера (тяжелыми хроническими процессами или острыми на момент включения), онкологическими заболеваниями, пациенты с семейной гиперхолестеринемией.

Ангиографический анализ: Рентгеноконтрастную коронарную ангиографию проводили по стандартной методике с использованием аппаратуры «Axiom Artis» фирмы Siemens (Германия). Анализ полученных ангиограмм проводился с помощью системы количественного компьютерного анализа Axiom Artis (Simens, Германия). При анализе ангиографических данных использовались следующие параметры: локализация сужения в коронарных артериях, степень сужения артерии (процент стеноза), количество сужений в коронарных артериях. Тяжесть коронарного атеросклероза определялась по индексу Gensini score (Gensini, 1983). Индекс Gensini score рассчитывается как сумма произведений индекса тяжести каждого стеноза и индекса функционального значения, рассчитанного для каждого сегмента коронарных артерий. Индекс тяжести стеноза определяется в соответствии с процентом уменьшения диаметра просвета коронарной артерии в месте бляшки (для сужений 25%, 50%, 75%, 90%, 99% и 100% определены индексы - 1, 2, 4, 8, 16 и 32, соответственно). Индекс функционального значения определяется по локализации бляшки в коронарных артериях (ствол левой коронарной артерии – 5, проксимальный сегмент передней нисходящей артерии – 2,5, проксимальный сегмент огибающей артерии – 2,5, средний сегмент передней нисходящей артерии – 1,5, правая коронарная артерия, дистальный сегмент передней нисходящей артерии, дистальный сегмент огибающей артерии, первая артерия тупого края, первая диагональная артерия, интермедиарная артерия, заднее-боковая артерия – 1, остальные сегменты – 0,5).

Генетические методы исследования: Венозную кровь собирали с ЭДТА в качестве антикоагулянта и хранили при -70°С. Выделение геномной ДНК цельной крови проводили методом высаливания с использованием реактивов набора «ДНК-Экстран-1» для выделения геномной ДНК фирмы «Синтол» (Россия). Измерение концентрации ДНК производили на нанофотометре IMPLEN, GmbH, Германия. Затем разводили ДНК водой mQ (18,2) до концентрации 10 нг/мкл. Определение полиморфизмов гена секФЛА2-IIА (PLA2G2A) проводили методом ПЦР в режиме «реального времени» на амплификаторе 7500 Fast Real-Time PCR System фирмы «Applied Biosystems» (США). Синтез праймеров и зондов произведен фирмой «Синтол» (Россия). Для амплификации использовали последовательности праймеров и зондов, представленных в таблицах 1 и 2.

Таблица 1. Последовательность праймеров для проведения ПЦР в режиме «реального времени».

tSNP Прямой праймер 5-3последовательность Обратный праймер 5-3последовательность
-655T/C CTGCCCTAGTGATCTCCTCTTAACT TCCCGGTACCTTAGAATGTGATCTT
763C/G CAGCCTTGTGCCTCACCTA CAGGCCGTCTTGTTTGTTCTG
1022G/T GTGTAAGAGAGGATGTTGGCACTAT GTTAACACACCTATGCCCACATACA
1983G/A CCCCAGACAGCTGACTCATG CTTAAAGGACTCAGGCCATGGG
4982T/A CAACTCCGTGCTTAACAAAGAAG GCTAACAGTGCATAGGGCAATG
5128T/G GGGAGGCTGAGGCTGAA GCTGGCCTTGAACTTCTGTGA

Таблица 2. Последовательность зондов для проведения ПЦР в режиме «реального времени».

tSNP Probe VIC labelled Probe ROX labelled
-655T/C TTTAAAAATAGGGTCATTGCAGAT(BHQ1) reverse AATAGGGTCGTTGCAGAT(BHQ2) reverse
763C/G CTTAAATAGCTGCTCCCTC(BHQ1) reverse CCTTAAATAGCTCCTCCCTC(BHQ2) reverse
1022G/T ACACTCTCGTACTTTACCT(BHQ1) reverse CACTCTCGTAATTACCT(BHQ2) reverse
1983G/A AAAAGCGTGGACTCC(BHQ1) forward AAAAGCGTAGACTCC(BHQ2) forward
4982T/A CACACATATACATGATTTG(BHQ1) reverse ACACACATATACTTGATTTG(BHQ2) reverse
5128T/G TCAAGCAATCATTGCAC(BHQ1) reverse CTCAAGCAATCCTTGCAC(BHQ2) reverse




В состав реакционной смеси помимо соответствующих праймеров (10 пкмоль) и зондов (5 пкмоль) входили по 200 мкМ каждого dNTP; Taq-полимераза 2,5 Ед (0,5 мкл раствора с содержанием 5 ед. полимеразы в 1 мкл); 2,5 мл 10-кратного буфера для Taq-полимеразы, 5 мкл раствора ДНК (10нг/мкл) и вода mQ 18,2 до 25 мкл. Температурный профиль реакции включал в себя денатурацию (95°С, 20 сек.), 50 циклов амплификации (95°С, 15 сек., затем 55°С 30 сек), отжиг праймеров и элонгацию (30 сек, температура различалась в зависимости от полиморфизма: 59о С для полиморфизмов -655T/C, 1022G/T, 5128T/G; 57о С для полиморфизмов 763C/G, 4982T/A; 55о С для полиморфизма 1983G/A). При наличии только дикого аллеля (что соответствовало гомозиготному генотипу по дикому аллелю) рост кривых амплификации наблюдался только в канале VIC. При наличии только минорного аллеля (что соответствовало гомозиготному генотипу по минорному аллелю) рост кривых амплификации наблюдался только в канале ROX. Визуализация кривых амплификации в обоих каналах VIC/ROX свидетельствовала о наличии как дикого, так и минорного аллеля и соответствовала гетерозиготному генотипу.

Биохимические методы исследования: Уровень секФЛА2-IIA в плазме крови определяли с помощью моноклональных антител, используя набор реактивов (sPLA2(IIA) (human synovial) enzyme immunoassay kit), полученный из Cayman Chemical Company (Ann Arbor, MI, USA). Эти антитела специфичны для секФЛА2-IIA и не имеют перекрёста с типом I, типом IV, типом V, типом VI и типом Х секФЛА2. Минимальная определяемая концентрация фермента 15.6 пг/мл. Полученные результаты выражали в нг/мл.

Активность секФЛА2-IIA определяли с помощью флуоресцентно меченого фосфатидилхолина на флуориметре Perkin Elmer 2030 Victor TMX3 multilabel rider (Финляндия). Настройки ридера соответствовали настройкам для флуоресценции (excitation = 485 нм, emission = 535 нм). Измерения проводили в 96-луночном планшете. Конечный объем образца в лунке составлял 200 мкл. Реакционная смесь содержала 20 мкл сыворотки, 0,9 мкМ флуоресцентно меченого субстрата, 100 мМ Tris -HCl буфера pH 8.0, 2 мMCaCl2. В качестве стандарта использовали секФлА2-IIA, выделенную из миксомы сердца человека (удельная активность фермента 36 мкмоль/мин/мг). Активность секФлА2-IIA в образцах крови пациентов выражали как нмоль/мин/мл.

Статистический анализ проводили с использованием пакета статистических программ STATISTICA 6.0 и SNP Stats. SNP Stats - программа, разработанная для анализа генетических эпидемиологих исследований для изучения ассоциаций полиморфизмов (SNP). С помощью данной программы для каждого выбранного SNP получены результаты: частота аллелей и генотипов, тест на распределение по закону Харди-Вайнберга, анализ ассоциации с необходимыми показателями на основе линейной или логистической регрессии. Для всех SNPs: вычисление неравновесного сцепления, оценка частоты гаплотипов, анализ ассоциации гаплотипов с ответом (Sole et al., 2006). При сравнении групп по количественному признаку использовались параметрический (t-критерий Стьюдента) и непараметрический (критерий Манна-Уитни) методы. При сравнении групп по качественному признаку использовался критерий 2 и точный критерий Фишера (для бинарных признаков). Для выявления взаимосвязи между показателями применяли непараметрический метод корреляционного анализа по Спирману. Параметры представлены в виде медианы, нижнего и верхнего квартилей (Med (LQ; HQ)). Статистически достоверными считали различия при p < 0,05.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ

В исследование включены 416 пациентов – мужчины и женщины в возрасте от 19 до 88 лет, которым была проведена диагностическая коронарография. Были сформированы две группы пациентов: 1 группа (n= 332) - с гемодинамически значимыми стенозами коронарных артерий и 2 группа (n=84) - без поражения коронарного русла по данным коронарографии. Группы были сопоставимы по основным клиническим параметрам, таким как возраст, индекс массы тела, наличие артериальной гипертонии, сахарного диабета 2 типа, нарушения толерантности к глюкозе. Мужчин оказалось достоверно больше в группе с атеросклерозом коронарных артерий, чем среди пациентов с интактными коронарными артериями (88% против 52%), также как и курящих (51% против 25%). Клиническая характеристика пациентов приведена в таблице 3. Учитывая высокий риск развития сердечно-сосудистых заболеваний у всех пациентов, включенных в исследование, большинство больных в обеих группах получали статины, однако достоверно чаще статины принимали пациенты в группе с атеросклерозом коронарных артерий (90% против 70%, р=0,0002) и уровень общего холестерина был достоверно ниже в этой группе пациентов по сравнению с группой с интактными коронарными артериями (4,71 против 5,3 ммоль/л, р=0,02). При этом уровень ХСЛВП был достоверно ниже в группе больных с коронарным атеросклерозом (1,09 против 1,3 ммоль/л, р=0,0003).

По таким показателям как ХС ЛНП, ТГ, Лп(а), уровни глюкозы, АЛТ, АСТ, КК группы не различались. Биохимические показатели представлены в таблице 4.

Таблица 3. Клиническая характеристика пациентов.

Группа без коронарного атеросклероза n=84 Группа с коронарного атеросклерозом n=332 р-уровень
Пол: - муж - жен 44 (52%) 40 (48%) 291 (88%) 41 (12%) 0,000001
Возраст, лет 57 (49-68) 59 (54-67) 0,08
ИМТ, кг/м2 29 (25-32) 28 (26-30) 0,5
АГ 73 (87%) 258 (78%) 0,12
СД 13 (16%) 46 (14%) 0,73
НТГ 4 (5%) 23 (7%) 1,00
Курение 21 (25%) 168 (51%) 0,00003
ИМ - 174 (52%) -
АКШ - 41 (12%) -
ТБКА - 54 (16%) -
Статины 59 (70%) 299 (90%) 0,0002
Gensini score 0 54 (27-90)

ИМТ – индекс массы тела, АГ – артериальная гипертензия, СД – сахарный диабет, НТГ – нарушение толерантности к глюкозе, ИМ – инфаркт миокарда, АКШ – аорто-коронарное шунтирование, ТБКА – транслюминальная баллонная коронарная ангиопластика.

Таблица 4. Биохимические показатели

Группа без коронарного атеросклероза n=84 Группа с коронарным атеросклерозом n=332 p-уровень
Общий ХС, ммоль/л 5,3 (4,27-6,17) 4,71 (4,12-5,5) 0,02
ХС ЛНП, ммоль/л 3,46 (2,43-4,2) 3,03 (2,38-3,81) 0,14
ХС ЛВП, ммоль/л 1,3 (1,04-1,48) 1,09 (0,91-1,29) 0,0003
ТГ, ммоль/л 1,38 (1,06-2,0) 1,5 (1,09-2,07) 0,29
Глюкоза, ммоль/л 5,26 (4,8-5,73) 5,3 (4,74-5,8) 0,95
Лп(а), мг/дл 13 (2,3-24,8) 10,5 (5,2-27,7) 0,34
АЛТ, Ед/л 23 (16-29) 21 (16-32) 0,75
АСТ, Ед/л 21 (19-25) 20 (16-25) 0,11
КК, Ед/л 94 (69-118) 95 (69-128) 0,56
Уровень секФЛА2-IIА, нг/мл 4,86 (2,63-7,16) 6,21 (3,99-8,99) 0,04
Активность секФЛА2-IIA, нмоль/мл/мин 1,2 (0,7-2,0) 1,6 (1,0-2,3) 0,048

АЛТ – аланинаминотрансфераза, АСТ – асатаминотрасфераза, КК – креатинфосфокиназа, общий ХС – общий холестерин, ТГ – триглицериды, ХС ЛНП – холестерин липопротеидов низкой плотности, ХС ЛВП - холестерин липопротеидов высокой плотности, Лп(а) – липопротеин (а).

В нашей работе уровень секФЛА2-IIA был достоверно выше в группе пациентов с коронарным атеросклерозом, чем у пациентов без атеросклероза коронарных артерий (6,21(3,99-8,99) против 4,86(2,63-7,16), р=0,04). Более того, по данным регрессионного анализа нами выявлено, что уровень секФЛА2-IIA ассоциирован с наличием коронарного атеросклероза (ОШ=1,13; 95%ДИ: 1,01-1,26; р=0,027) (рисунок 1). Данные нашего исследования совпадают с полученными ранее данными исследования (Kugiyama et al., 2000), в котором также было показано, что уровень секФЛА2-IIA являлся предиктором наличия коронарного атеросклероза. Аналогичные данные об ассоциации уровня секФЛА2-IIA с развитием в дальнейшем ИБС были получены и в исследовании EPIC-Norfolk, хотя необходимо отметить, что в это исследование изначально включались практически здоровые люди без клиничеcких проявлений ИБС (Mallat et al., 2007; Boekholdt et al., 2005). Учитывая основное влияние на развитие атеросклероза традиционных факторов риска, таких как пол, возраст, курение, артериальная гипертония, сахарный диабет, ХС ЛПВП, для определения роли секФЛА2-IIA нами, также как и в исследованиях Kugiyama и EPIC-Norfolk, был проведен многофакторный анализ с учетом вышеперечисленных факторов риска. В указанных работах по результатам многофакторного анализа уровень секФЛА2-IIA был независимым предиктором развития коронарного атеросклероза, в отличие от нашего исследования, в котором после коррекции на указанные факторы риска ассоциация была недостоверной (ОШ корр.=1,09; 95%ДИ 0,93-1,27; р=0,3). Тем не менее, по данным нашего исследования уровень секФЛА2-IIA может рассматриваться как дополнительный фактор риска наличия коронарного атеросклероза. Активность секФЛА2-IIA, также как уровень секФЛА2-IIA, в нашем исследовании достоверно выше в группе пациентов с коронарным атеросклерозом, чем у пациентов без атеросклероза коронарных артерий (1,6 (1,0-2,3) против 1,2 (0,7-2,0), р=0,048) и по данным регрессионного анализа ассоциирована с наличием коронарного атеросклероза (ОШ=1,64; 95%ДИ: 1,04-2,59; р=0,033) (рисунок 1), что совпадает с данными исследования EPIC-Norfolk (Boekholdt et al., 2005). После коррекции по тем же факторам риска достоверность не сохранялась (ОШ корр. =1,28; 95%ДИ: 0,74-2,22; р=0,37). Следовательно, по данным нашего исследования активность секФЛА2-IIA, также как и уровень секФЛА2-IIA, не является независимым фактором риска, однако может рассматриваться в качестве дополнительного фактора риска наличия коронарного атеросклероза.

 Ассоциация уровня и активности секФЛА2-IIA с коронарным-0 Ассоциация уровня и активности секФЛА2-IIA с коронарным-1

Рисунок 1. Ассоциация уровня и активности секФЛА2-IIA с коронарным атеросклерозом.

Выраженность коронарного атеросклероза в настоящей работе определялась по индексу Gensini score, который является одним из наиболее точных методов определения степени выраженности коронарного атеросклероза, т.к. подсчет индекса Gensini score производится с учетом степени сужения сосуда, локализации бляшек в коронарных артериях, а также количества бляшек (Gensini, 1983). Проанализировав влияние традиционных факторов риска развития атеросклероза на степень поражения коронарного русла, определяемой по индексу Gensini score, выявлено, что у мужчин индекс Gensini score был выше, чем у женщин (r =-0,34; р<0,000001), у курящих индекс Gensini score также был выше, чем у некурящих пациентов (r=0,19; р=0,0007). Кроме того, была выявлена достоверная положительная корреляция между индексом Gensini Score и уровнем глюкозы крови (r=0,17, p=0,012) и достоверная отрицательная корреляция между индексом Gensini Score и уровнем ХС ЛПВП (r=-0,35, p=0,000004) (рисунок 2). Данные нашего исследования согласуются с результатами ранее проведенных исследований, в которых была выявлена положительная корреляция между индексом Gensini score и возрастом, уровнем глюкозы, полом (у мужчин индекс Gensini score был выше, чем у женщин) (Jiaen-zhi et al., 2005) и отрицательная корреляция с ХС ЛВП (Tarchalski et al., 2003). В нашем исследовании не было выявлено корреляции между индексом Gensini score и возрастом, индексом массы тела, артериальной гипертонией, отягощенным анамнезом, уровнем ХС ЛНП, ТГ и Лп(а). Отсутствие корреляции между степенью поражения коронарного русла и уровнем Лп(а) возможно объясняется тем, что в среднем уровень Лп(а) составил 23 мг/дл. Наши данные совпадают с данными исследования, в котором также не было показано ассоциации между индексом Gensini score и Лп(а), в том числе и у больных с сахарным диабетом. Отсутствие корреляции между индексом Gensini score и уровнем ХС ЛНП и ТГ в нашем исследовании объясняется тем фактом, что в отличие от ранее проведенного исследования (Tarchalski et al., 2003), в нашем - пациенты получали статины, а также тем, что уровни ТГ не превышали нормальных значений.

 Корреляция индекса Gensini Score с полом, курением, уровнем-2 Корреляция индекса Gensini Score с полом, курением, уровнем-3 Корреляция индекса Gensini Score с полом, курением, уровнем-4 Корреляция индекса Gensini Score с полом, курением, уровнем-5

Рисунок 2. Корреляция индекса Gensini Score с полом, курением, уровнем глюкозы и ХС ЛВП.

В проведенных ранее исследованиях по изучению ассоциации секФЛА2-IIA с выраженностью поражения коронарных артерий было показано, что уровень и активность секФЛА2-IIA были связаны со степенью поражения коронарного русла. Так, было показано, что как активность так и уровень секФЛА2-IIA увеличиваются пропорционально выраженности поражения коронарного русла при распределении пациентов на группы по одно-, двух- и трехсосудистому поражению коронарных артерий (р<0,0001 для всех) (Koenig et al., 2009). Аналогичные результаты продемонстрированы и в другой работе (Lima et al., 2010), хотя в этом исследовании определяли только активность секФЛА2-IIA. В данных исследованиях степень выраженности коронарного атеросклероза определялась либо по количеству пораженных артерий, (при этом учитывались только атеросклеротические бляшки, уменьшающие просвет сосуда более 50% и не учитывались стенозы менее 50%), либо по степени максимального стеноза и при этом не учитывалось количество бляшек. Таким образом, эти исследования имеют ряд ограничений, т.к. ни в одном из указанных исследований не учитывалась локализация стеноза в коронарных артериях и поэтому судить о степени выраженности коронарного атеросклероза можно лишь в определенной степени. В нашей работе мы постарались учесть недостатки ранее проведенных исследований и потому использовали метод оценки степени поражения с помощью Gensini score. В результате работы мы не выявили достоверной корреляции между индексом Gensini score и активностью секФЛА2-IIА (r=0,06, р=0,46), при этом была выявлена тенденция к достоверности ассоциации между уровнем секФЛА2-IIА и индексом Gensini score (r=0,15, р=0,056) (рисунок 3).

 Корреляция между индексом Gensini Score и уровнем секФЛА2-IIА и-6 Корреляция между индексом Gensini Score и уровнем секФЛА2-IIА и-7

Рисунок 3. Корреляция между индексом Gensini Score и уровнем секФЛА2-IIА и активностью секФЛА2-IIА.

Таким образом, нами выявлена ассоциация между полом, курением, уровнем ХС ЛПВП и глюкозой со степенью выраженности коронарного атеросклероза. При этом роль секФЛА2-IIA представляется менее значимой, но, тем не менее, нами выявлена тенденция к достоверности связи между уровнем секФЛА2-IIA и степенью выраженности коронарного атеросклероза.

Исходя из поставленных задач, у всех больных были определены 6 полиморфизмов гена секФЛА2-IIА – PLA2G2A: -655T/C (rs1774131), 763C/G (rs11573156), 1022G/T (rs3753827), 1983G/A (rs2236771), 4982T/A (rs876018), 5128T/G (rs3767221) которые составляют 92% изменчивости гена (Wootton et al., 2006). Все полиморфизмы гена секФЛА2-IIА имели распределение соответствующее закону Харди-Вайнберга, кроме 1983G/A, поэтому он был исключен из дальнейшего анализа.

У каждого пациента определены генотипы всех 6 полиморфизмов гена PLA2G2A. Не было получено статистически значимых различий распределения генотипов между группами с коронарным атеросклерозом и без атеросклероза коронарных артерий.

Мы проанализировали взаимосвязь генотипов данных полиморфизмов, а также гаплотипов гена секФЛА2-IIА (PLA2G2A) с показателями уровня и активности секФЛА2-IIА, наличием или отсутствием коронарного атеросклероза, а также с индексом Gensini score.

В работе было показано, что носительство минорного аллеля разных полиморфизмов может ассоциироваться как с повышением, так и с понижением уровня секФЛА2-IIA (рисунок 4). Так, например, нами выявлено, что гомозиготы по минорному аллелю полиморфизма -655T/C имеют достоверно более высокий уровень секФЛА2-IIА по сравнению с гетерозиготами и гомозиготами по дикому аллелю (8,55 против 6,59 и 5,06 нг/мл, р<0,00001). Эти данные согласуются с результатами исследования UDACS гена (Wootton et al., 2006), в котором также показано, что гомозиготы по минорному аллелю полиморфизма -655T/C имеют достоверно более высокий уровень секФЛА2-IIA по сравнению с гомозиготами по дикому аллелю.

Гомозиготы по минорному аллелю полиморфизма 763C/G также имеют достоверно более высокий уровень секФЛА2-IIА по сравнению с гетерозиготами и гомозиготами по дикому типу данного полиморфизма (10,23 против 7,89 и 4,77 нг/мл, р<0,00001), что также подтверждается данными исследований UDACS и KAROLA (Wootton et al., 2006; Koenig et al., 2009), в которых гомозиготы по минорному аллелю полиморфизма 763C/G имели более высокий уровень массы секФЛА2-IIА по сравнению с гомозиготами по дикому аллелю.

Обратный эффект по влиянию на уровень секФЛА2-IIA у гомозигот по минорному аллелю полиморфизмов 1022C/G и 5128T/G. Так, нами получены данные, что гомозиготы по минорному аллелю полиморфизмов 1022C/G и 5128T/G имеют более низкие значения уровня секФЛА2-IIА по сравнению с другими вариантами генотипов данных полиморфизмов. Эти данные также сопоставимы с результатами других исследований, в которых гомозиготы по минорному аллелю полиморфизма 1022G/T (Wootton et al., 2006; Koenig et al. 2009) и полиморфизма 5128Т/G (Wootton et al., 2006) имели достоверно более низкий уровень секФЛА2-IIА по сравнению с гомозиготами по дикому типу.

В отношении полиморфизма 4982T/A, у пациентов с различными генотипами данного полиморфизма уровень секФЛА2-IIА достоверно не различался, также как и исследовании UDACS.

Рисунок 4. Полиморфизмы гена PLA2G2A и уровень секФЛА2-IIA.

Что касается активности секФЛА2-IIА, то в нашем исследовании также как и в исследованиях KAROLA и FAST-MI (Simon et al., 2008), мы изучали ассоциацию генотипов указанных полиморфизмов с активностью секФЛА2-IIA. В нашей работе не было выявлено достоверных различий данного показателя с носительством разных генотипов каждого полиморфизма. Наши данные не согласуются с результатами этих работ, в которых было показано, что носители минорных аллелей 763C/G ассоциированы с повышением активности фермента, а минорные аллели полиморфизмов 1022G/T, 5128T/G с понижением активности секФЛА2-IIA. Это, вероятно, объясняется тем, что в исследование FAST-MI включались пациенты с ОКС, а в исследование KAROLA включались пациенты, которых весьма условно можно отнести к группе стабильных пациентов, т.к. у них определяли уровень и активность секФЛA2-IIA в среднем через 43 дня после перенесенного ИМ или реваскуляризации, в то время как в наше исследование включались стабильные пациенты.

Для оценки связи полиморфизмов с наличием коронарного атеросклероза проведен регрессионный анализ, по результатам которого ассоциации каждого отдельно взятого полиморфизма с наличием или отсутствием коронарного атеросклероза не выявлено. В дальнейшем мы оценивали ассоциацию генотипов указанных полиморфизмов с наличием коронарного атеросклероза. При этом мы не выявили статистически значимых различий распределения генотипов каждого полиморфизма между группами с коронарным атеросклерозом и без атеросклероза коронарных артерий (рисунок 5).

 Распределение генотипов полиморфизмов в группах с наличием и-13 Рисунок 5. Распределение генотипов полиморфизмов в группах с наличием и отсутствием коронарного атеросклероза.

С целью проверки гипотезы о возможности ассоциации секФЛА2-IIA со степенью поражения коронарного русла в подгруппе больных с атеросклерозом также проанализирован индекс Gensini score. У пациентов с различными генотипами каждого полиморфизма данный показатель достоверно не различался у носителей различных генотипов каждого из полиморфизмов (рисунок 6). Таким образом, носительство того или иного генотипа каждого из изученных полиморфизмов не было ассоциировано со степенью выраженности атеросклероза коронарных артерий.

Рисунок 6. Ассоциация полиморфизмов PLA2G2A с индексом Gensini score.

Все полиморфизмы имеют высокую степень неравновесного сцепления в гене PLA2G2A и поэтому в нашей работе мы проанализировали гаплотипы, то есть совокупность аллей изученных полиморфизмов в гене каждого пациента. В нашей выборке пациентов 7 гаплотипов встречались с частотой более 5%, все остальные объединены в группу редких гаплотипов. При анализе уровня секФЛА2-IIА у носителей различных гаплотипов, было установлено, что гаплотип CGGTT, являющийся самым распространенным в нашей выборке пациентов (частота встречаемости - 22%) ассоциирован с достоверно более высоким уровнем секФЛА2-IIA (8,41 нмоль/мл/мин) по сравнению со всеми другими гаплотипами (р=0,00013). После коррекции на факторы, которые традиционно влияют на уровень секФЛА2-IIA – пол, возраст, сахарный диабет, прием статинов ассоциация гаплотипа CGGTT с уровнем секФЛА2-IIA сохранялась статистически значимой (р=0.00012) (таблица 5). В ранее проведенных работах (Simon et al., 2008; Wootton et al., 2006) также проводился анализ гаплотипов и самыми распространенными оказались гаплотипы, отличные от нашего, что, возможно, обусловлено разницей в выборках пациентов и популяциях.

Таблица 5. PLA2G2AtSNP гаплотипы и их ассоциация с уровнем секФЛА2-IIА

-655 763 1022 4982 5128 Частота Средний уровень секФЛА-IIA, нмоль/мл/мин р-уровень   р-уровень корр*
1 C G G T T 0.2217 8,41 ---  ---
2 T C G T G 0.1681 5,15 <0.0001 <0.0001
3 T C T A T 0.1206 5,68 <0.0001 <0.0001
4 T C T T T 0.1177 5,16 <0.0001 <0.0001
5 T C T T G 0.0833 5,56 <0.0001 0.00015
6 C C G T G 0.0636 4,93 <0.0001 <0.0001
7 T C G T T 0.0561 5,65 0.0098 0.021
редкие * * * * * 0.1688 5,94 <0.0001 <0.0001

Общий р-уровень для ассоциации гаплотипов: 0.00013;

Общий р-уровень для ассоциации гаплотипов после коррекции: 0.00012

*Коррекция на пол, возраст, сахарный диабет, прием статинов.

Хотя отдельно каждый полиморфизм не был достоверно ассоциирован с активностью секФЛА2-IIA, при анализе гаплотипов было выявлено, что один из часто встречающихся гаплотипов TCGTT ассоциирован с достоверно более высокой активностью секФЛА2-IIA по сравнению с наиболее распространенным гаплотипом в нашей выборке пациентов (2,185 против 1,395 нмоль/мл/мин, р=0,0007). Однако, после коррекции на пол, возраст, сахарный диабет и прием статинов достоверность не сохраняется (р=0,14).

Таким образом, по данным нашего исследования можно сделать заключение о том, что, по всей видимости, изученные полиморфизмы оказывают большее влияние на уровень секФЛА2-IIA и в меньшей степени на активность секФЛА2-IIA.

В нашей работе был проведен анализ взаимосвязи гаплотипов с наличием коронарного атеросклероза. Выявлено, что все редкие гаплотипы (с частотой встречаемости менее 5%) ассоциированы с меньшим риском коронарного атеросклероза по сравнению с наиболее распространенным в нашей выборке (ОШ=0,53; 95%ДИ: 0,28-0,99; р=0,048). После коррекции на классические факторы риска развития атеросклероза, такие как пол, возраст, курение, АГ, СД, уровень ХС ЛВП, прием статинов, статистическая значимость не сохраняется (ОШ=0,51; 95%ДИ: 0,22-1,21; р=0,13). В работе был проведен анализ взаимосвязи гаплотипов с индексом Gensini score, при этом ассоциации ни одного из гаплотипов с данным показателем не выявлено.

В ранее проведенных исследованиях не изучалась ассоциация данных полиморфизмов гена секФЛА2-IIA с наличием коронарного атеросклероза и степенью его выраженности. Изучалась только влияние этих полиморфизмов на уровень, активность секФЛА2-IIA, и сердечно-сосудистые осложнения у пациентов с ОКС (Koenig et al., 2009; Simon et al., 2008; Wootton et al., 2006) или влияние уровня и активности секФЛА2-IIA на тяжесть коронарного атеросклероза и сердечно-сосудистые события также у больных с ОКС. В нашем исследовании нам удалось показать, что в нашей выборке пациентов, включающей больных со стабильной ИБС и пациентов с ангиографически неизменными коронарными артериями, уровень фермента генетически детерминирован и ассоциирован с наличием коронарного атеросклероза, при этом имеется тенденция к ассоциации уровня секФЛА2-IIA и степени выраженности атеросклеротического поражения коронарных артерий. В то же время, было выявлено, что все редкие гаплотипы ассоциированы с меньшим риском коронарного атеросклероза по сравнению с наиболее распространенным в нашей выборке и самым негативным по влиянию на уровень секФЛА2-IIA.

Таким образом, из нашей работы следует, что полиморфизмы гена секФЛА2-IIA опосредованно влияют на развитие атеросклероза путем повышения уровня секФЛА2-IIA. При этом влияние полиморфизма на степень выраженности атеросклероза требует проведения дальнейших исследований в связи с тем, что в нашей работе была получена тенденция к взаимосвязи между генетически детерминированным повышением фермента и тенденцией к ассоциации его со степенью выраженности коронарного атеросклероза.

ВЫВОДЫ

1. Повышение уровня и активности секФЛА2-IIА ассоциировано с наличием коронарного атеросклероза.

2. Уровень и активность секФЛА2-IIA не ассоциированы с выраженностью коронарного атеросклероза, при этом пол, курение, уровень ХС ЛПВП и глюкозы ассоциированы с индексом Gensini score.

3. Носительство минорных аллелей полиморфизмов -655T/C и 763C/G гена PLA2G2A ассоциировано с повышением уровня секФЛА2-IIA, а полиморфизмов 1022G/T и 5128T/G – со снижением уровня секФЛА2-IIА. Каждый отдельно проанализированный полиморфизм не был ассоциирован с наличием коронарного атеросклероза и индексом Gensini score.

4. Доминирующий гаплотип CGGTT гена PLA2G2A ассоциирован с самым высоким уровнем секФЛА2-IIА. Гаплотип TCGTT ассоциирован с более высокой активностью секФЛА-IIA по сравнению с доминирующим гаплотипом CGGTT в нашей выборке. По сравнению с доминирующим гаплотипом CGGTT все редко встречаемые гаплотипы ассоциированы с меньшим риском коронарного атеросклероза. Ассоциации гаплотипов со степенью атеросклеротического поражения не выявлено.

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ

Измерение уровня и активности секФЛА2-IIA может быть предложено к рассмотрению в качестве дополнительного биохимического маркера наличия коронарного атеросклероза.

СПИСОК ОПУБЛИКОВАННЫХ РАБОТ ПО ТЕМЕ

  1. Каминный А. И., Павлунина Т. О., Шувалова Ю. А., Коротаева А.А. Роль секреторной фосфолипазы А2 в развитии атеросклероза. Атеросклероз и дислипидемии №4, 2012. стр. 62-66.
  2. Павлунина Т. О., Шувалова Ю. А., Коротаева А.А. Самойлова Е.В., Каминная В. И., Масенко В.П., Каминный А. И., Кухарчук В. В. Взаимосвязь уровня и активности секреторной фосфолипазы А2 группы IIА с выраженностью атеросклеротического поражения коронарных артерий. Атеросклероз и дислипидемии №4, 2012. стр. 72-76.
  3. Павлунина Т.О., Шувалова Ю.А., Каминная В.И., Казначеева­ Е.И., Тутунов В.С., Маргиева О.В., Каминный А.И. Ассоциация классических факторов риска сердечно-сосудистыхт заболеваний и факторов воспаления с тяжестью коронарного атеросклероза. Современны­е проблемы науки и образовани­я. – 2012. – № 6; URL: http://www.science-education.ru/106-7993.
  4. Korotaeva A., Samoilova E., Pavlunina T., Panasenko O. Modified phospholipids formed in inflammation are involved in secretory phospholipase A2 group IIA regulation Fourth European Workshop on Lipid Mediators, Paris, September 27-28, 2012. Poster 55.
  5. A. Korotaeva, E. Samoilova, T. Pavlunina, N. Prokazova, O.Panasenko. Halogenated phospholipids suppress the activity of secretory phospholipase А2 type IIA. 8th GERLI lipidomics meeting. INSA de Lyon, France, October 26-28, 2011. Poster 27.
  6. T.O. Pavlunina, Y. A. Shuvalova, V.N. Titov, V.P. Masenko, A.I. Kaminnyi Relationship between the level of IL-6 and Lp(a) and the lesions of coronary arteries Proceedings of the 80th European Atherosclerosis Society Congress, Milan, Italy May 25-28, 2012. Abstract А-437-0007-00633. Soc

СПИСОК СОКРАЩЕНИЙ

ИМТ – индекс массы тела

АГ – артериальная гипертензия

СД – сахарный диабет

НТГ – нарушение толерантности к глюкозе

ИМ – инфаркт миокарда

АКШ – аорто-коронарное шунтирование

ТБКА – транслюминльная баллонная коронарная ангиопластика

АЛТ – аланинаминотрансфераза

АСТ – асатаминотрасфераза

КК – креатинфосфокиназа

общий ХС – общий холестерин

ТГ – триглицериды

ХС ЛНП – холестерин липопротеидов низкой плотности

ХС ЛВП - холестерин липопротеидов высокой плотности

Лп(а) – липопротеин (а)

ИБС – ишемическая болезнь сердца

секФЛА2-IIA – секреторная фосфолипаза А2 группы 2А

ОКС – острый коронарный синдром

КАГ – коронарная ангиография



 





<
 
2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.