WWW.DISUS.RU

БЕСПЛАТНАЯ НАУЧНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

Изменение патогенного потенциала е. faecalis при взаимодествии с м. hominis в условиях ассоциативного симбиоза репродуктивного тракта

На правах рукописи

Орлина Маргарита Анатольевна

ИЗМЕНЕНИЕ ПАТОГЕННОГО ПОТЕНЦИАЛА Е. FAECALIS ПРИ ВЗАИМОДЕСТВИИ С М. HOMINIS В УСЛОВИЯХ АССОЦИАТИВНОГО СИМБИОЗА РЕПРОДУКТИВНОГО ТРАКТА

03.02.03 микробиология

Автореферат

диссертации на соискание ученой степени

кандидата биологических наук

Оренбург- 2012

Работа выполнена в ФГБОУ ВПО «Ульяновский государственный университет»

Научный руководитель:

доктор медицинских наук, профессор Потатуркина-Нестерова Наталия Иосифовна

Официальные оппоненты:

доктор медицинских наук Институт клеточного и внутриклеточного симбиоза УрО РАН КАРТАШОВА Ольга Львовна
доктор биологических наук, профессор Саратовский технический университет Тихомирова Елена Ивановна

Ведущая организация:

ФГБОУ ВПО «Сибирский государственный медицинский университет»

Предполагаемая дата защиты диссертации 16 февраля 2012 г. в __ часов на заседании диссертационного совета Д.208.066.03 при Оренбургской государственной медицинской академии по адресу: 460000, г.Оренбург, ул. Советская, д.6, зал заседаний диссертационного совета.

Тел.: (3532) 77-59-95; факс: (3532) 77-24-59; e-mail: orgma@esoo.ru, официальный сайт: www.orgma.ru

С диссертацией можно ознакомиться в библиотеке ОрГМА

Автореферат разослан «____»_________________ 2012 г., автореферат и текст объявления размещен на официальном сайте ВАК Министерства образования и науки Российской Федерации.

Ученый секретарь

диссертационного совета

доктор медицинских наук,

профессор Немцева Наталия Вячеславовна

ВВЕДЕНИЕ

Актуальность

Изучение симбиозов в настоящее время заняло одно из приоритетных мест в ряду актуальных проблем современной биологии. Ассоциативный симбиоз – это многокомпонентная интегральная система, в которой существует макросимбионт (хозяин), а также микросимбионты – доминантные и ассоциативные микроорганизмы (Бухарин, 2006). В составе таких симбиоценозов, как правило, наблюдается разделение доминантного и ассоциативных микросимбионтов с разнонаправленным действием, определяющим формирование, стабильность существования и продуктивность симбиоза в целом (Проворов В.Н., 2001; Бухарин О.В., 2007).

Микробиоценоз репродуктивного тракта женщин можно рассматривать в качестве важнейшего примера ассоциативного симбиоза человека. Данный биотоп, в отличие от других, имеет один доминантный таксон (лактобациллы) и несколько таксонов ассоциированных микроорганизмов, которые в случае повышения патогенного потенциала могут являться основным или дополнительным этиологическим фактором патологического процесса (Бухарин О.В., Усвяцов Б.Я., Хуснутдинова Л.М., 2000, 2003, 2007).

Урогенитальная система женщины весьма сложна и характеризуется сложной микроэкологической структурой, значение отдельных компонентов которой недостаточно изучено (Кафарская Л.И. и соавт., 2001; Назарова Е.К. и соавт., 2003; Гобечия М., 2004; Наумкина Е.В., Рудаков Н.В., 2009). Так, например, еще не оценена в должной мере роль микоплазм в инфекционной патологии человека.

Широко распространенное носительство микоплазм можно рассматривать как патогенный потенциал этих микроорганизмов, так как оно приводит к развитию многочисленных патологических состояний (Прилепская В.Н., Быковская О.В., 2005; Lidbric P., 2004). Совокупность характерных для микоплазм свойств, таких как их убиквитарность, мембранный паразитизм, способность преодолевать тканевые барьеры, отсутствие выраженного тропизма, многокомпонентность факторов вирулентности свидетельствует об особом характере взаимодействия микоплазм с организмом хозяина (Мальцева Л.И., Зефирова Т.П. и соавт., 2005; Макаров О.В. и соавт., 2007; Зигангирова Н.А., 2008). В связи с этим чрезвычайно интересным представляется рассмотрение роли микоплазм в формировании измененных микробных симбиозов (Данилов Е.Ю., 2007). Изучены механизмы взаимодействия макро- и микрокомпонентов АС, а также ДМ и АМ (Константинова О.К, 2004). Однако взаимное влияние на биологические свойства в системе «АМ-АМ», определяющие их патогенность и стабильность микросимбиоценоза в целом остаются не изученными.

Целью исследования явилось выявление изменения патогенного потенциала Еnterococcus faecalis при взаимодействии с Мycoplasma hominis в условиях ассоциативного симбиоза репродуктивного тракта.

Для реализации этой цели были сформулированы следующие задачи:

  1. Дать характеристику микробиоценоза репродуктивного тракта женщин при воспалительных заболеваниях, вызванных М. hominis.
  2. Определить фенотипические проявления и генетические детерминанты патогенности клинических изолятов М. hominis в условиях ассоциативного симбиоза репродуктивного тракта женщин.
  3. Выявить биологические свойства и изменения встречаемости генетических детерминант патогенности микросимбионта Е. faecalis, выделенного из микробных консорциумов репродуктивного тракта женщин при наличии и отсутствии в них микоплазм.
  4. Дать оценку патогенного потенциала микросимбионтов после их взаимодействия в условиях сокультивирования in vitro.

Научная новизна

Впервые установлено, что в результате симбиотического взаимодействия при воспалительных заболеваниях репродуктивного тракта происходит изменение патогенного потенциала Е. faecalis при взаимодействии с М. hominis в условиях ассоциативного симбиоза репродуктивного тракта, проявляющегося в увеличении частоты встречаемости генетических детерминант патогенности обоих микросимбионтов.

Выявлено нарушение стабильности ассоциативного симбиоза репродуктивного тракта женщин при воспалительных заболеваниях, вызванных M. hominis, проявляющееся снижением доминирования основных симбионтов на фоне увеличения частоты встречаемости и повышения вирулентности ассоциативной микрофлоры. Показано, что при воспалительных заболеваниях РТ, вызванных микоплазмами, среди условно-патогенных бактерий доминирует микросимбионт Е. faecalis.

Впервые обнаружено достоверное увеличение распространенности генетических детерминант патогенности у клинических изолятов M. hominis (р120) и E. fаecalis (сylm, cpd и cps генов) после их сокультивирования с вирулентными штаммами ассоцианта in vitro.

Теоретическая и практическая значимость

Результаты проведенных исследований вносят вклад в развитие теоретических основ учения об ассоциативных симбиозах. Полученные в работе данные расширяют и углубляют представления о характере межмикробных взаимодействий, определяющих формирование и поддержание симбиоценоза репродуктивного тракта женщин, в частности, впервые установлено взаимное влияние на патогенный потенциал минорных ассоциантов.

Данные, полученные при изучении взаимодействия М. hominis и E. fаecalis, свидетельствуют о необходимости определения патогенности микросимбионтов для оценки их этиологической значимости и прогнозирования течения заболевания. Предложено также с целью улучшения качества диагностики микоплазменных инфекций внедрение в работу бактериологических лабораторий диагностических показателей патогенности микроорганизмов, что позволит оптимизировать диагностику и выявлять риск формирования патомикробиоценозов.

Основные положения диссертационной работы внедрены в практику клинико-диагностической лаборатории ГУЗ Областного клинического кожно-венерологического диспансера г. Ульяновска, а также включены в лекционные курсы и практические занятия по микробиологии в ФГБОУ ВПО «Ульяновский государственный университет».

По материалам диссертационной работы опубликованы практические рекомендации «Микробиоценоз репродуктивного тракта женщин при воспалительных заболеваниях» (г.Ульяновск, 2011).

Основные положения, выносимые на защиту

  1. Воспалительные заболевания репродуктивного тракта женщин, вызванные М.hominis, сопровождаются дестабилизацией ассоциативного симбиоценоза, что проявляется угнетением доминантной микрофлоры на фоне повышения показателей частоты встречаемости и колонизационной резистентности ассоциативных симбионтов.
  2. Минорные микросимбионты в условиях конкурентной борьбы внутри ассоциативного симбиоза оказывают взаимное влияние, стимулирующее накопление детерминант патогенности ассоцианта. Этот механизм имеет важное значение в развитии воспалительных заболеваний репродуктивного тракта, т.к. взаимодействие микросимбионтов в ассоциации М. hominis-E. fаecalis способствует формированию штаммов с высоким патогенным потенциалом.

Апробация работы

Диссертация выполнена в соответствии с планом научной работы ФГБОУ ВПО «Ульяновский государственный университет».

Результаты работы представлены на заочной электронной конференции «Экологические проблемы внутренних болезней перинатологии и педиатрии» (2008 г.), конференции молодых ученых с международным участием «Актуальные вопросы инфекционной патологии-2009» (г.Санкт-Петербург, 2009 г.), международной конференции «Диагностика, терапия профилактика социально значимых заболеваний человека» (Турция, 2009 г.), Российской научно-практической конференции с международным участием «Высшее сестринское образование в системе российского здравоохранения» (г. Ульяновск, 2010 г.).

Публикации

По материалам диссертации опубликовано 12 научных работ, из них 3 в изданиях, рекомендованных ВАК РФ; 1 практические рекомендации.

Объем и структура диссертации

Диссертация изложена на 147 страницах. Состоит из введения, обзора литературы, 4 глав собственных исследований и их обсуждения, выводов, практических рекомендаций и списка использованной литературы. Список включает 223 источника, в том числе 140 – отечественных и 83 – зарубежных авторов. Работа иллюстрирована 29 таблицами и 16 рисунками.

Содержание работы

Материалы и методы исследования

Работа выполнена на базе клинико-диагностической лаборатории Ульяновского областного клинического кожно-венерологического диспансера и научно-исследовательской лаборатории ИМЭиФК УлГУ в период с ноября 2008 по ноябрь 2010 г.г.

Обследовано 425 женщин в возрасте от 18 до 51 года с воспалительными заболеваниями репродуктивной системы – А, К и ЭЦ. Из них у 168 женщин (39,5%) были выделены штаммы Mycoplasma hominis. Из 168 женщин с воспалительными заболеваниями РТ 75 пациенток были больны А (44,6%), 53 – К (31,6%) и 40 – ЭЦ (23,8%). Полученные данные сравнивали с результатами исследования 75 практически здоровых женщин, репрезентативных по возрасту. С целью определения видового состава и биологических свойств микрофлоры производили взятие материала из заднего свода влагалища и цервикального канала.

Количественную и качественную оценку состава вагинального микроценоза производили в соответствии с Приказом МЗ СССР №535 от 22.04.85. «Об унификации микробиологических методов исследования, применяющихся в клинико-диагностических лабораториях» и Приказом Минздрава России от 28.12.1995 г. № 691 «О профилактике внутрибольничных инфекций в акушерских стационарах г. Москвы». При диагностике ИППП использовали Приказ № 286 «Об улучшении выявления больных гонорей и трихомониазом в акушерских и гинекологических отделениях (палатах, кабинетах), женских консультациях и урологических кабинетах)» и Приказ МЗ РФ №415 от 20.08.2003. «Гонокковая инфекция».

Для выявления микоплазм использовали культуральный метод, РПИФ с контрастированием фона и ПЦР. При выделении микоплазм бактериологическим методом проводили посев исследуемого материала в универсальную жидкую транспортную среду (НИИ эпидемиологии и микробиологии им. Пастера, г. С.-Петербург) с последующим пересевом в среду «Микоплазма-50» (НИИ эпидемиологии и микробиологии им. Пастера г. С.-Петербург) и среды, содержащую лошадиную сыворотку, дрожжевой экстракт и пенициллин из расчета 1000 ед./мл (BioMeriox, Франция). Положительным результатом считалось наличие микоплазм в количестве более 104 КОЕ/мл (Дмитриев Г.А., 2007). Для выделения культур энтерококков использовали энтерококк агар ( НПЦ, г.Оболенск) с последующим накоплением на средах: Columbia agar (Bio-Rad, Франция) и Diskinson Oxoid (Himedia, Индия).

Определение чувствительности энтерококков к химиопрепаратам производили диско-диффузным методом на агаре Мюллера-Хинтона (Испания) (МУ 4.2.1890-04.2004). Чувствительность микоплазм проводили при помощи тест-системы «МИКОПЛАЗМА-АЧ», «МИКОПЛАЗМА-П-120» (НИИ эпидемиологии и микробиологии им. Пастера, г.С.-Петербург) и Mycoplasma IST (BioMeriox, Франция). Для выявления чувствительности микроорганизмов определяли минимальную ингибирующую концентрацию препарата – МИК в ЕД/мл или мкг/мл (Навашин С.М., Чучалин А.Г., Белоусов А.М., 1998). Вирулентность клинических изолятов определяли внутрибрюшинной пробой на белых мышах (Костюкова Н.Н.с соавт., 1996).

Для выявления микроорганизмов и определения их генетических детерминант патогенности применяли ПЦР (МУ 1.3. 2569-09). С целью обнаружения M. hominis применяли готовые наборы Полимик-МК (НПФ «Литех», Москва) (табл.1).

Таблица 1

Использованные в работе праймеры

Ген Фактор патогенности Пары праймеров: прямой/обратный Размер ампликона н.п.
Праймеры энтерококков Enterococcus faecalis
1 Cylm (токси-генность, цитолизин), 5'ACAGGGAGACTCTCATAGTCGCGG 3' 5'CCCCGTGCCGGGGTGCCTGGACCTG 3' 296
2 cpd (бактерии-оциогенность) 5' CGCGTGAAGAACAAATGGCCGC 3' 5'GCTTTCCTGGTAGTTGGCGTAGG 3' ' 528
3 cps (адгезия и колонизация) 5' GGCATCGAAGCTAATGGGTGGGT 3' 5' GCTTTCCTGGTAGTTGGCGTAG G 3' 298
Праймер Mycoplasma. hominis
4 P-120-адгезия 5’ TGCGGTTCTTCCTTTGATTGCTAGTT 3' 5’GGGTTTTGCTGFFGGATGCTACCAG 3' 527

Подбор праймеров и температуры отжига осуществляли при использовании пакета программ в Gene Runner Version 3.05 и Primer Blast (ресурсы GeneBank) (США). Праймеры микоплазм и энтерококков были синтезированы в «ЗАО Симтол» (Москва). Регистрацию результатов ПЦР осуществляли путем электрофоретического разделения продуктов амплификации на окрашенном бромистом этидием агарозном геле. Компьютерный анализ нуклеотидных последовательностей проводили с помощью компьютерной программы Vector NTI Suite (США).

Все полученные данные подвергали математической обработке с определением коэффициента достоверности Стьюдента. Статистическую обработку материала осуществляли с помощью пакета программ Statistica 8,0.

Результаты исследований и их обсуждение

При воспалительных заболеваниях РТ женщин, вызванных М. hominis, выявлена дестабилизация АС данного биотопа у 85,5% обследованных женщин (в группе сравнения 14,5%). Это проявлялось снижением частоты встречаемости доминантной микрофлоры на фоне увеличения количественных показателей ассоциативных симбионтов.

Прежде всего данные изменения касались представителей рода Lactobacillus – ДМ РТ, определяющего состояние его колонизационной резистентности. Лактобациллы были выделены у 48,8% обследованных женщин, тогда как у здоровых данный показатель составлял 86,7%. Частота встречаемости лактобацилл во влагалище была в 1,8 раз, а в цервикальном биотопе в 1,3 раза меньше, чем у здоровых женщин (табл.2).

Все случаи ВЗРТ сопровождались снижением показателей плотности колонизации и частоты встречаемости ДМ, L. fermentum высевались в 2,2 раза, L. acidophilus – в 0,5 раза, L.plantarum – в 0,8 раза, L. casei – в 0,7 раза реже, чем у здоровых женщин.

Таблица 2

Показатель микробной обсемененности (ПМО) доминантного и ассоциативных симбионтов при воспалительных заболеваниях репродуктивного тракта (lg КОЕ/мл)

Виды микроорганизмов Влагалище Цервикальный канал
Доминантный симбионт
Lactobacillus spp. 4,2±1,05 1,24±0,29*
Ассоциативные симбионты
Staphylococcus epidermidis 4,71±1,26* 3,01±1,15
S. hominis 2,51±1,26 6,71±2,06*
S. agalactiae 4,51±1,31* 2,02±1,06
Escherichia сoli 4,80±2,72 4,31±0,81
Enterococcus faecalis 7,61±1,72* 4,20±0,82*
Bifidobacterium spp. 2,05±1,04* 1,51±0,17*
Corynebacterium spp. 5,4±1,13* 3,42±0,73
Propionibacterium spp. 1,04±0,17 1,10±0,15
Candida spp. 2,41±0,55* 1,58±0,95-

Примечание * - достоверность различия показателя по сравнению со здоровыми женщинами (р<0,05).

Плотность колонизации ассоциативных симбионтов при воспалительных заболеваниях репродуктивного тракта также претерпевала изменения. Из всех ассоциативных симбионтов максимальное увеличение показателей частоты встречаемости и ПМО отмечалось у Enterococcus faecalis (табл. 2).

Результаты исследования показали, что Mуcoplasma hominis были выделены при А у 44,6%, К – 31,6%, ЭЦ – 23,8% пациенток.

Клинические изоляты М. hominis обладали типичными культурально-биохимическими свойствами и высокой чувствительностью к джозамицину, доксициклину, тетрациклину и низкой – к левофлоксацину, спарфлоксацину, моксифлоксацину и пефлоксацину.

Выявление вирулентности бактерий методом внутрибрюшинного заражения мышей показало, что из 168 клинических изолятов М.hominis только 123 (73,2%) вызывали гибель мышей. Уровень LD50/lg этих штаммов варьировал от 3,2±0,2 до 5,3±0,4. В зависимости от величины данного показателя эти штаммы были разделены на три группы: слабо,- умеренно- и высоковирулентные.

Микоплазмы являются мембранными паразитами, поэтому адгезивная активность является важнейшим проявлением их способности вызывать патологический процесс. Основным адгезином M. hominis является липопротеин р120 (Д.Н.Балабанов, 2009).

В связи с этим далее при помощи ПЦР было проведено выявление гена р120, детерминирующего адгезивную активность М. hominis, у 168 вирулентных штаммов М. hominis, выделенных у пациенток с ВЗРТ, и 75 клинических изолятов, полученных у здоровых женщин. Положительный сигнал был получен у 57,1% штаммов первой группы и у 5,3% культур второй группы. Следовательно, было выявлено достоверное различие (р<0,05) в содержании гена р120 у микоплазм, изолированных у больных и здоровых женщин (рис. 1).

 Содержание р 120 гена у М.hominis, выделенного при воспалительных-1

Рис.1 - Содержание р 120 гена у М.hominis, выделенного при воспалительных заболеваниях и у здоровых женщин.

Исследования показали, что распространенность нуклеотидной последовательности р120 гена микоплазм изменялась в зависимости от их вирулентности. У слабо вирулентных штаммов показатель его частоты встречаемости составил 17,8±3,2% (р>0,05), у умеренно вирулентных – 33,3±6,1% (р<0,05) и у высоко вирулентных – 48,8±7,5% (р<0,05). Распространенность данной детерминанты патогенности микоплазм, выделенных у здоровых женщин, не превышала 9,3±2,5%.

Наиболее частыми ассоциативными симбионтами микоплазм являлись энтерококки. В связи с этим было проведено изучение распространенности нуклеотидных последовательностей генов ампликонов р120 М. hominis после совместного их культивирования с энтероккоками in vitro (табл.3).

Таблица 3

Частота встречаемости нуклеотидных последовательностей гена р120 у штаммов M. hominis

Штаммы М. hominis в ассоциации с энтероккоками: Культивирование Частота встречаемости фрагмента р 120 гена (%)
слабо вирулентными до сокультивирования 3,8±0,5
после 3-х суток сокультивирования 5,2±0,8
умеренно вирулентными до сокультивирования 3,1±0,3
после 3-х суток сокультивирования 5,6±0,8*
высоко вирулентными до сокультивирования 25,4±5,8*
после 3-х суток сокультивирования 58,4±7,1*

Примечание: * - показатель достоверности различий между показателями частоты встречаемости нуклеотидных последовательностей ген р120 у культур М. hominis до и после их сокультивирования с энтероккоками (р<0,05).

Проведенные исследования показали, что распространенность нуклеотидной последовательности гена р120 микоплазм, как правило, возрастала после совместного культивирования с E. fаecalis в течение первых трех суток и зависела от вирулентности энтерококков.

Далее были изучены биологические свойства и изменение патогенного потенциала клинических изолятов энтерококков при ассоциативном симбиотическом взаимодействии с М.hominis in vivo и при их сокультивировании in vitro.

Из всех обследованных женщин энтерококки были выделены из влагалищного и цервикального биотопов у 46,9% и 25,8 % здоровых и 26,6% и 16,6% больных соответственно. ПМО Е.faecalis при воспалительных заболеваниях репродуктивной системы увеличивались во влагалище в 1,5 раза, а в цервикальном канале – в 1,7 раза.

Изучение вирулентности клинических изолятов Е. faecalis при помощи биопробы показало, что из 237 штаммов энтерококков, выделенных у женщин с воспалительными заболеваниями репродуктивной системы, только 187 (78,9%) вызывали гибель животных, показатель LD50 /lg этих штаммов варьировал от 3,6±0,1 до 5,7±0,6. В зависимости от величины данного показателя эти штаммы были разделены на три группы. LD50/lg штаммов первой группы (39 штаммов) составлял 3,6±0,1- 4,4±0,3; второй группы – 4,5±0,4-5,0±0,5 (97 штаммов) и третьей группы - 5,1±0,7–5,7±0,6 (51 штамм), наибольшее количество изолятов (51,9%) обладало умеренно выраженной вирулентностью.

Патогенность является полидетерминантным признаком, поэтому у энтерококков, выделенных у женщин с ВЗРТ, производили выявление следующих генетических детерминант: сylm (токсигенность, цитолизин), cpd (бактериоциногенность) и cps (адгезия и колонизация). Для проведения ПЦР был произведен подбор праймеров для выявления генов патогенности энтерококков, а также оптимизация условий и режима проведения ПЦР в режиме «реального времени», позволяющих одновременно совмещать амплификацию и детекцию. На последнем этапе производили проверку специфичности выбранных пар праймеров (cpd, cps и сylm генов) на музейном штамме E. fаecalis №111 (рис.2).

.

 Результаты проверки специфичности праймера для выявления адгезивной-2

Рис.2 - Результаты проверки специфичности праймера для выявления адгезивной активности микоплазм: положительный ответ с культурой Enterococcus faecalis, Staphylococcus epidermidis (2), Staphylococcus hominis (3), Streptococcus agalactiae (4), Escherichiae сoli (5), М.hominis (6), Bifidobacterium spp. (7), Corynebacterium spp. (8), Propionibacterium spp. (9), Candida spp. (10).

С целью расшифровки механизмов развития ВЗРТ и оценки значения ассоциативной микрофлоры у пациенток изучали взаимное влияние микросимбионтов на их патогенный потенциал. Для этого используя набор праймеров, амплифицирующих фрагменты генов cpd, cps и cylm, было протестировано 142 штамма E. faecalis, выделенных из ассоциаций с М. hominis различной степени вирулентности после их совместного культивирования, а также 87 штаммов энтерококков, выделенных из микробных консорциумов, где микоплазмы не являлись участником микробного сообщества.

Обращает на себя внимание достоверно более широкая распространенность нуклеотидных последовательностей генов сylm, cpd, cps после 3-х суток сокультивирования с микоплазмами, по сравнению с данными, полученными до сокультивирования, особенно значительной она была после сокультивирования с высоко вирулентными М. hominis (табл.4).

Таблица 4

Частота встречаемости нуклеотидных последовательностей гена cpd у

культуры E. fаecalis

Штаммы E. fаecalis, выделенные в ассоциации с микоплазмами: Совместное культивирование Частота встречаемости фрагмента cpd гена (%)
слабо вирулентными (n=29) до сокультивирования 3,4±0,5
после 3-х суток сокультивирования 3,8±0,2
умеренно вирулентными (n=76) до сокультивирования 14,4± 1,7
после 3-х суток сокультивирования 19,7±2,7*
высоко вирулентными (n=37) до сокультивирования 54,1±2,9
после 3-х суток сокультивирования 86,5±3,5*

Примечание: * - показатель достоверности различия между уровнем частоты встречаемости нуклеотидных последовательностей гена cpd у культур E. fаecalis до и после их сокультивирования с М. hominis (р<0,05)

Тестирование штаммов E. faecalis на наличие гена cps, выделенного из ассоциации с слабо вирулентными, умеренно вирулентными и высоко вирулентными микоплазмами, также подтвердило зависимость роста числа положительных сигналов с праймерами, специфичными к cps гену, от вирулентности ассоциантов (г=0,87), как до, так и после сокультивирования (табл.5).

Выявление гена cylm у штаммов E. faecalis после их сокультивирования с микоплазмами различной вирулентности показало увеличение частоты встречаемости искомых ампликонов, что свидетельствовало о повышении патогенности энтерококков (табл. 6).

Следовательно, в результате взаимоадаптации микросимбионтов М.hominis и E. faecalis с различной вирулентностью в условиях макроорганизма и in vitro происходило увеличение численности особей, в генотипе которых локализованы сylm, cpd и cps гены, что является свидетельством их взаимного влияния на способность реализации патогенного потенциала в условиях ассоциативного симбиоза

Таблица 5

Частота встречаемости нуклеотидных последовательностей ген cps у культур

E. fаecalis

E. fаecalis в ассоциации с микоплазмами: Совместное культивирование Частота встречаемости фрагмента ген cps гена (%)
слабо вирулентными (n=29) до сокультивирования 4,1±0,6
после 3-х суток сокультивирования 4,9±0,8
умеренновирулентными (n=76) до сокультивирования 15,7 ±0,7
после 3-х суток сокультивирования 22,3 ±2,7*
высоковирулентными (n=37) до сокультивирования 67,5±3,5
после 3-х суток сокультивирования 92,5±4,5*

Примечание: * - показатель достоверности различия между показателями частоты встречаемости нуклеотидных последовательностей cps гена E. fаecalis до и после их сокультивирования с микоплазмами (р<0,05).

Взаимодействие ассоциативных симбионтов приводит к селекции и накоплению вирулентных вариантов в бактериальной популяции, которая может стать микроорганизмами, этиологически ассоциированными с воспалительными заболеваниями репродуктивного тракта.

Таким образом, проведенная работа по характеристике взаимного влияния микросимбионтов в условиях симбиоценоза на патогенный потенциал ассоциантов выявила перспективность использования комплексного симбиотического подхода в решении фундаментальных и прикладных задач микробной экологии.

Результаты исследования свидетельствуют о необходимости учета при диагностике и прогнозировании течения воспалительных заболеваний репродуктивного тракта оценку динамики патогенного потенциала микросимбионтов, реализуемых через молекулярно-генетические механизмы взаимоадаптации микроорганизмов к изменяющимся условиям биотопа.

Таблица 6

Частота встречаемости гена cylm у культур E. fаecalis

Штаммы E. fаecalis в ассоциации с микоплазмами: Совместное культивирование Частота встречаемости фрагмента cylm гена (%)
слабо вирулентными (n=29) до сокультивирования 6,8±0,8
после 3-х суток сокультивирования 7,3±0,3
умеренно- вирулентными (n=76) до сокультивирования 35,5±1,3
после 3-х суток сокультивирования 46,7±1,7*
высоковирулентными (n=37) до сокультивирования 48,6±7,2
после 3-х суток сокультивирования 78,3±6,4 *

Примечание: * - показатель достоверности между показателями частоты встречаемости нуклеотидных последовательностей cylm гена E. fаecalis. до и после их сокультивирования с микоплазмами (р<0,05).

ВЫВОДЫ

  1. Выявлено нарушение стабильности ассоциативного симбиоза при воспалительных заболеваниях репродуктивного тракта женщин, вызванных М. hominis, проявляющегося в угнетении его доминантного компонента (Lactobacillus spp.) на фоне повышения содержания минорных симбионтов, таких как Corynebacterium spp., Streptococcus spp., грибы рода Candida. Максимальное увеличение показателей частоты встречаемости в биотопах влагалища, цервикального канала и колонизационной активности отмечалось у ассоцианта Е. faecalis.
  2. В условиях ассоциативного симбиоза при воспалительных заболеваниях репродуктивной системы M. hominis были выявлены у 44,6% больных аднекситом, у 31,6% пациенток с кольпитом и у 23,8% – эндоцервицитом. Из общего пула выделенных штаммов микоплазм 73,2% обладали вирулентностью и 57,1% содержали ген р120, детерминирующий адгезивную активность (у здоровых женщин 5,3%). При повышении вирулентности микоплазм частота встречаемости искомого ампликона достоверно возрастала от 17,8±3,2% у слабо вирулентных до 48,8±7,5% у высоко вирулентных штаммов (в группе сравнения – 9,3±2,5%; р0,05), а чувствительность к химиопрепаратам снижалась.
  3. При воспалительных заболеваниях репродуктивного тракта микоплазменной этиологии микросимбионт Е. faecalis обнаруживался почти в два раза чаще, чем у здоровых женщин, 78,9% клинических изолятов Е. faecalis были вирулентными. В результате подавления ассоциативных микросимбионтов происходило увеличение частоты выявления генетических детерминант патогенности энтерококков, выделенных из микробных консорциумов при наличии в них микоплазм – сylm (токсигенности, цитолитической активности), cpd (бактериоциногенности) и cps (адгезии и колонизации). При отсутствии микоплазм в микробиоценозе достоверного изменения количества участков генов патогенности не происходило.
  4. Установлено, что в результате ассоциативного симбиотического взаимодействия M. hominis и Е. faecalis in vitro происходило накопление генетических детерминант патогенности, что приводило к формированию штаммов микросимбионтов, обладающих более выраженной патогенностью. Совместное культивирование E. fаecalis с вирулентными микоплазмами вызывало увеличение показателей частоты встречаемости участков генов, детерминирующих факторы патогенности, особенно значительным оно было после сокультивирования с высоко вирулентными М. hominis. В группе энтероккоков, выделенных из микробных консорциумов, в которых отсутствовали микоплазмы, частота встречаемости генетических детерминант сylm, cpd и cps достоверно не изменялась.

Список работ, опубликованных по теме диссертации

Публикации в научных журналах, рекомендованных ВАК РФ

  1. Эффективность использования ПЦР-диагностики воспалительных заболеваний урогенитального тракта / Н.И Потатуркина-Нестерова., М.А. Орлина, И.С. Немова // Вестник новых медицинских технологий. – 2011 – №4 – С. 81-83.
  2. Мониторинг микробиоценоза урогенитального тракта женщин при микоплазменных инфекциях / И.С. Немова, Н.И. Потатуркина-Нестерова М.А. Орлина, А.В. Мясникова // Вестник новых медицинских технологий. – 2011 – №1 – С. 34-37.
  3. Изменение патогенного потенциала энтерокков при взаимодействии с микоплазмами в условиях ассоциативного симбиоза репродуктивного тракта женщин. / М.А. Орлина, И.С. Немова, Н.И. Потатуркина-Нестерова // Естественные и технические науки. – 2011. – №6. – С. 42-46.
  4. Особенности микробиоты урогенитального тракта женщин с избыточным весом при воспалительных заболеваниях внутренних половых органов / Ивандеева О.И., Немова И.С., Потатуркина-Нестерова Н.И., Орлина М.А / Фундаментальные исследования. – №6. – 2010. – С. 42-47.

Публикации в других изданиях

  1. Особенности микробиоты кожи при урологических инфекциях/ Н.И. Потатуркина-Нестерова, М.А. Орлина, И.С. Немова //Успехи современного естествознания – 2008. – №5. – С. 125.
  2. Особенности видового состава микрофлоры при воспалительных заболеваний внутренних половых органов / Н.И. Потатуркина-Нестерова, М.А. Орлина, И.С. Немова, М.А. Авдеенко // Современные наукоемкие технологии. – 2008. – №6. – С. 12.
  3. Особенности состава вагинальной микробиоты при урогенитальных инфекциях / Н.И. Потатуркина-Нестерова, М.А. Орлина, И.С. Немова, А.В. Мясникова // Материалы научной конференции молодых ученых с международным участием «Актуальные вопросы инфекционной патологии – 2009». Санкт – Петербург – 2009. – С. 63.
  4. Резистентность уреаплазм и рациональная антибиотикотерапия / Н.И. Потатуркина-Нестерова, М.А. Орлина И.С. Немова // Диагностика, терапия, профилактика социально значимых заболеваний человека, научная международная конференция, 16-23 августа (Турция). – Журнал Eropin Journal Of Natural Москва. – 2010. – №1 – С.11.
  5. Микрофлора влагалища как индикатор репродуктивного здоровья женщин /А.В. Мясникова, М.А. Орлина, И.С. Немова //Материалы российской научно-практической конференции с международным участием – 2010. – 15-16 декабря – Ульяновск. – С. 115 – 116.
  6. Роль микоплазм в урогенитальной патологии / Н.И. Потатуркина-Нестерова, М.А. Орлина, И.С. Немова // Международный журнал прикладных и фундаментальных исследований. – 2010. – №1. – С. 56 – 59.
  7. Выявление микоплазм при урогенитальных инфекциях / М.А. Орлина, И.С. Немова // Медицинский академический журнал. – 2010. – Т. 10. – №5 – С. 146 – 147.
  8. Антибиотикорезистентность возбудителя урогенитального уреаплазмоза / Н И. Потатуркина-Нестерова, М.А. Орлина, И.С. Немова, А.В. Мясникова // Современные наукоемкие технологии – 2010. – №8. – С.139.

ПЕРЕЧЕНЬ ПРИНЯТЫХ СОКРАЩЕНИЙ

А – аднексит

АМ – ассоциативный микросимбионт

АС – ассоциативный симбиоз

БВ – бактериальный вагиноз

ВЗРТ – воспалительные заболевания репродуктивного тракта

ДМ – доминантный микросимбионт

К – кольпит

КОЕ/ мл – колониеобразующая единица

КР – колонизационная резистентность

МС – макросимбионт (хозяин)

МИК – минимальная ингибирующая концентрация

ПМО – плотность микробного обсеменения

РТ – репродуктивный тракт

ЭЦ – эндоцервицит

____________________________________________________________________

Подписано в печать… Тираж 100 экз. Заказ №…

Оригинал-макет изготовлен с помощью текстового редактора Microsoft Word 2003 for Mindowsтм. Гарнитура таймс. Подписано в печать 12.12.2011 г.

Формат 64х84 1/16. Усл.печ.л. – 1,0. Печать офсетная. Тираж 100 экз.



 



<
 
2013 www.disus.ru - «Бесплатная научная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.